Incidental Mutation 'R8509:Ndufb4'
ID655776
Institutional Source Beutler Lab
Gene Symbol Ndufb4
Ensembl Gene ENSMUSG00000022820
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex 4
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R8509 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location37647170-37654453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37649144 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 66 (I66T)
Ref Sequence ENSEMBL: ENSMUSP00000023514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023514]
Predicted Effect probably benign
Transcript: ENSMUST00000023514
AA Change: I66T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023514
Gene: ENSMUSG00000022820
AA Change: I66T

DomainStartEndE-ValueType
Pfam:NDUF_B4 5 128 5.5e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 116,104,434 S181P possibly damaging Het
4932415D10Rik A G 10: 82,291,116 V2020A probably benign Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ano3 T C 2: 110,665,835 E858G possibly damaging Het
Asrgl1 T C 19: 9,114,226 K244E probably damaging Het
BC048679 T A 7: 81,495,368 T82S probably benign Het
Brip1 A T 11: 86,197,948 C42* probably null Het
Cabcoco1 T C 10: 68,431,289 E296G probably damaging Het
Ccnb1ip1 T C 14: 50,792,257 N116S probably benign Het
Cep95 A G 11: 106,805,050 E214G probably benign Het
Cyp11b1 A G 15: 74,839,353 F159L possibly damaging Het
Dmxl2 C A 9: 54,428,057 E660* probably null Het
Dnah14 C T 1: 181,814,655 T112M Het
Fancd2 A G 6: 113,572,570 T74A probably benign Het
Fat4 G T 3: 38,981,903 V3235L probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gmcl1 A C 6: 86,722,607 I146S probably damaging Het
Hbb-bs T A 7: 103,826,712 K133* probably null Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hmcn1 T A 1: 150,573,551 K5446* probably null Het
Hyal6 A T 6: 24,734,606 E179D probably damaging Het
Inpp5b T A 4: 124,743,905 probably null Het
Lrba A G 3: 86,348,176 K942E probably benign Het
Lrrcc1 A G 3: 14,536,507 N110S probably damaging Het
Mcoln3 A G 3: 146,124,892 I126V probably benign Het
Ncoa7 T C 10: 30,696,052 I242V probably benign Het
Npffr2 T C 5: 89,583,329 S373P possibly damaging Het
Olfr1165-ps T C 2: 88,101,522 Y155C probably benign Het
Pi4ka A T 16: 17,354,144 I579N Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ripk2 T C 4: 16,124,436 E424G probably benign Het
Rnf19b T A 4: 129,073,576 C304S probably damaging Het
Rtp1 T C 16: 23,429,314 W46R probably damaging Het
Ryr2 A G 13: 11,577,778 probably null Het
Sbf1 A T 15: 89,293,457 D1674E probably damaging Het
Sgf29 T A 7: 126,671,662 probably benign Het
Slc22a8 T C 19: 8,607,975 probably null Het
Smg6 T C 11: 75,041,876 S998P probably benign Het
Srgap3 G A 6: 112,731,336 Q801* probably null Het
Taf4b A G 18: 14,898,055 D832G probably damaging Het
Trim12a T C 7: 104,306,027 D163G probably benign Het
Trim46 A G 3: 89,245,713 probably null Het
Trpm4 A G 7: 45,322,361 V274A probably damaging Het
Unc80 A G 1: 66,641,629 D2128G possibly damaging Het
Other mutations in Ndufb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02584:Ndufb4 APN 16 37649170 splice site probably benign
R4389:Ndufb4 UTSW 16 37647670 missense probably benign
R5345:Ndufb4 UTSW 16 37654178 critical splice donor site probably null
R8252:Ndufb4 UTSW 16 37654275 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACCACTAGGAACTGCTGG -3'
(R):5'- TTCTGAATAGTAGAACCAGTCAGG -3'

Sequencing Primer
(F):5'- GGCACCTAGGAGGGACTTC -3'
(R):5'- CCAGTCAGGTGGGAGTCATG -3'
Posted On2020-10-20