Mutagenetix > Incidental Mutations

Incidental Mutation 'R8509:Taf4b'

655777

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R8509 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14898055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 832 (D832G)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000169862
AA Change: D832G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: D832G

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Meta Mutation Damage Score

0.9042

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004F10Rik	T	C	7: 116,104,434	S181P	possibly damaging	Het
4932415D10Rik	A	G	10: 82,291,116	V2020A	probably benign	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ano3	T	C	2: 110,665,835	E858G	possibly damaging	Het
Asrgl1	T	C	19: 9,114,226	K244E	probably damaging	Het
BC048679	T	A	7: 81,495,368	T82S	probably benign	Het
Brip1	A	T	11: 86,197,948	C42*	probably null	Het
Cabcoco1	T	C	10: 68,431,289	E296G	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,257	N116S	probably benign	Het
Cep95	A	G	11: 106,805,050	E214G	probably benign	Het
Cyp11b1	A	G	15: 74,839,353	F159L	possibly damaging	Het
Dmxl2	C	A	9: 54,428,057	E660*	probably null	Het
Dnah14	C	T	1: 181,814,655	T112M		Het
Fancd2	A	G	6: 113,572,570	T74A	probably benign	Het
Fat4	G	T	3: 38,981,903	V3235L	probably benign	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gmcl1	A	C	6: 86,722,607	I146S	probably damaging	Het
Hbb-bs	T	A	7: 103,826,712	K133*	probably null	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hmcn1	T	A	1: 150,573,551	K5446*	probably null	Het
Hyal6	A	T	6: 24,734,606	E179D	probably damaging	Het
Inpp5b	T	A	4: 124,743,905		probably null	Het
Lrba	A	G	3: 86,348,176	K942E	probably benign	Het
Lrrcc1	A	G	3: 14,536,507	N110S	probably damaging	Het
Mcoln3	A	G	3: 146,124,892	I126V	probably benign	Het
Ncoa7	T	C	10: 30,696,052	I242V	probably benign	Het
Ndufb4	A	G	16: 37,649,144	I66T	probably benign	Het
Npffr2	T	C	5: 89,583,329	S373P	possibly damaging	Het
Olfr1165-ps	T	C	2: 88,101,522	Y155C	probably benign	Het
Pi4ka	A	T	16: 17,354,144	I579N		Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ripk2	T	C	4: 16,124,436	E424G	probably benign	Het
Rnf19b	T	A	4: 129,073,576	C304S	probably damaging	Het
Rtp1	T	C	16: 23,429,314	W46R	probably damaging	Het
Ryr2	A	G	13: 11,577,778		probably null	Het
Sbf1	A	T	15: 89,293,457	D1674E	probably damaging	Het
Sgf29	T	A	7: 126,671,662		probably benign	Het
Slc22a8	T	C	19: 8,607,975		probably null	Het
Smg6	T	C	11: 75,041,876	S998P	probably benign	Het
Srgap3	G	A	6: 112,731,336	Q801*	probably null	Het
Trim12a	T	C	7: 104,306,027	D163G	probably benign	Het
Trim46	A	G	3: 89,245,713		probably null	Het
Trpm4	A	G	7: 45,322,361	V274A	probably damaging	Het
Unc80	A	G	1: 66,641,629	D2128G	possibly damaging	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTTCAGTGGGTTGAGCCTTC -3'
(R):5'- AGCAGTGGTCTTCCATACTCC -3'

Sequencing Primer
(F):5'- CAGTGGGTTGAGCCTTCCATAATAC -3'
(R):5'- TGGTCTTCCATACTCCAAGGGAG -3'

Posted On

2020-10-20