Incidental Mutation 'R8510:Phyh'
ID655785
Institutional Source Beutler Lab
Gene Symbol Phyh
Ensembl Gene ENSMUSG00000026664
Gene Namephytanoyl-CoA hydroxylase
SynonymsLnap1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8510 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location4919019-4938730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4927433 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 110 (D110G)
Ref Sequence ENSEMBL: ENSMUSP00000027975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027975]
Predicted Effect probably benign
Transcript: ENSMUST00000027975
AA Change: D110G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027975
Gene: ENSMUSG00000026664
AA Change: D110G

DomainStartEndE-ValueType
Pfam:PhyH 61 277 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high phytol diet, mice homozygous for a null allele exhibit hepatic lipidosis and steatosis, ataxia, peripheral neuropathy and loss of spermatogonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A T 17: 42,719,540 C9* probably null Het
Avil A G 10: 127,009,781 N331S probably benign Het
Casp1 G A 9: 5,303,026 R160H probably damaging Het
Celsr3 T C 9: 108,838,120 F2105L possibly damaging Het
Cenpf A T 1: 189,650,706 S2664T probably benign Het
Cfap221 T A 1: 119,989,447 K75* probably null Het
Cmtr2 T C 8: 110,222,435 V459A possibly damaging Het
Col5a3 A T 9: 20,793,732 D740E unknown Het
Crybg2 C A 4: 134,073,359 A301E probably benign Het
Cwf19l2 A G 9: 3,454,732 I682V possibly damaging Het
Dach1 T C 14: 97,903,159 D521G probably damaging Het
Dync1h1 T A 12: 110,616,743 Y425N possibly damaging Het
Emc3 G T 6: 113,531,389 H32N probably damaging Het
Exosc10 T C 4: 148,564,189 L304P probably damaging Het
Fam160b1 A T 19: 57,382,320 K557I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gldc T A 19: 30,116,505 Y704F probably damaging Het
Gm11077 A G 6: 140,729,306 N8S unknown Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gm906 T C 13: 50,250,192 M25V probably benign Het
Gpam A G 19: 55,080,382 probably null Het
Gss G A 2: 155,567,824 Q300* probably null Het
Hydin T A 8: 110,506,570 L1767H probably damaging Het
Igf2r A G 17: 12,704,313 V1203A probably benign Het
Kcnf1 T A 12: 17,175,938 D94V probably damaging Het
Kif18a T A 2: 109,296,764 Y348N probably damaging Het
Klc4 G A 17: 46,644,304 A68V possibly damaging Het
Lhx4 G T 1: 155,702,301 T365K probably damaging Het
Mid1 A G X: 169,985,023 E389G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myo1e C T 9: 70,335,265 A354V probably damaging Het
Ncoa1 T C 12: 4,259,303 N1331S probably benign Het
Npas2 T C 1: 39,287,472 S13P probably damaging Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Olfr218 T C 1: 173,203,844 S163P probably damaging Het
Olfr547 A G 7: 102,534,963 D72G probably damaging Het
Olfr670 G T 7: 104,960,114 S206* probably null Het
Olfr703 A G 7: 106,844,923 E104G probably benign Het
Olfr806 A G 10: 129,738,185 V244A probably benign Het
Pcdh12 T C 18: 38,282,056 D672G possibly damaging Het
Pcolce2 T C 9: 95,681,647 Y229H probably damaging Het
Pga5 C T 19: 10,677,944 V10M possibly damaging Het
Pias1 C T 9: 62,923,637 R163H probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pole T C 5: 110,334,446 Y2051H probably damaging Het
Rbbp8 A T 18: 11,696,802 K141* probably null Het
Rin2 T A 2: 145,885,691 V827E probably damaging Het
Spatc1 A G 15: 76,292,312 Y421C probably damaging Het
Strada T C 11: 106,171,158 Y152C probably damaging Het
Top1mt A G 15: 75,669,302 V212A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Tubgcp6 C A 15: 89,102,949 G1274W possibly damaging Het
Unc79 T A 12: 103,104,639 I1231N probably damaging Het
Upp2 T C 2: 58,780,106 S275P probably damaging Het
Usp4 T A 9: 108,388,382 probably null Het
Usp47 A G 7: 112,059,001 T196A probably damaging Het
Vmn2r116 A T 17: 23,385,931 K73* probably null Het
Wdr74 T A 19: 8,737,910 H144Q probably benign Het
Zan A T 5: 137,388,938 M4951K unknown Het
Other mutations in Phyh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Phyh APN 2 4930793 missense probably null 1.00
R0552:Phyh UTSW 2 4936101 missense probably damaging 1.00
R1624:Phyh UTSW 2 4925683 missense probably benign 0.11
R1656:Phyh UTSW 2 4938353 missense probably damaging 0.97
R1721:Phyh UTSW 2 4937809 missense probably null 0.24
R3161:Phyh UTSW 2 4937671 splice site probably benign
R5353:Phyh UTSW 2 4942201 unclassified probably benign
R5907:Phyh UTSW 2 4930651 splice site probably null
R6093:Phyh UTSW 2 4919085 missense possibly damaging 0.51
R6188:Phyh UTSW 2 4927490 missense probably damaging 0.96
R6394:Phyh UTSW 2 4936003 missense probably benign 0.02
R7316:Phyh UTSW 2 4936044 nonsense probably null
X0060:Phyh UTSW 2 4938350 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCCACAAGCATTTACTCTACTAG -3'
(R):5'- ACCTGCCATGAAGCTGATGG -3'

Sequencing Primer
(F):5'- TACTCTACTAGATCAGAGAAGCAGTC -3'
(R):5'- CTGCCATGAAGCTGATGGGAAAG -3'
Posted On2020-10-20