Incidental Mutation 'R8510:Olfr670'
ID655798
Institutional Source Beutler Lab
Gene Symbol Olfr670
Ensembl Gene ENSMUSG00000044705
Gene Nameolfactory receptor 670
SynonymsMOR32-8, GA_x6K02T2PBJ9-7589577-7588639
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8510 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104957114-104962620 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 104960114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 206 (S206*)
Ref Sequence ENSEMBL: ENSMUSP00000151138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]
Predicted Effect probably null
Transcript: ENSMUST00000050482
AA Change: S206*
SMART Domains Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: S206*

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.7e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 211 4.5e-7 PFAM
Pfam:7tm_1 43 293 3.9e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214216
AA Change: S206*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A T 17: 42,719,540 C9* probably null Het
Avil A G 10: 127,009,781 N331S probably benign Het
Casp1 G A 9: 5,303,026 R160H probably damaging Het
Celsr3 T C 9: 108,838,120 F2105L possibly damaging Het
Cenpf A T 1: 189,650,706 S2664T probably benign Het
Cfap221 T A 1: 119,989,447 K75* probably null Het
Cmtr2 T C 8: 110,222,435 V459A possibly damaging Het
Col5a3 A T 9: 20,793,732 D740E unknown Het
Crybg2 C A 4: 134,073,359 A301E probably benign Het
Cwf19l2 A G 9: 3,454,732 I682V possibly damaging Het
Dach1 T C 14: 97,903,159 D521G probably damaging Het
Dync1h1 T A 12: 110,616,743 Y425N possibly damaging Het
Emc3 G T 6: 113,531,389 H32N probably damaging Het
Exosc10 T C 4: 148,564,189 L304P probably damaging Het
Fam160b1 A T 19: 57,382,320 K557I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gldc T A 19: 30,116,505 Y704F probably damaging Het
Gm11077 A G 6: 140,729,306 N8S unknown Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gm906 T C 13: 50,250,192 M25V probably benign Het
Gpam A G 19: 55,080,382 probably null Het
Gss G A 2: 155,567,824 Q300* probably null Het
Hydin T A 8: 110,506,570 L1767H probably damaging Het
Igf2r A G 17: 12,704,313 V1203A probably benign Het
Kcnf1 T A 12: 17,175,938 D94V probably damaging Het
Kif18a T A 2: 109,296,764 Y348N probably damaging Het
Klc4 G A 17: 46,644,304 A68V possibly damaging Het
Lhx4 G T 1: 155,702,301 T365K probably damaging Het
Mid1 A G X: 169,985,023 E389G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myo1e C T 9: 70,335,265 A354V probably damaging Het
Ncoa1 T C 12: 4,259,303 N1331S probably benign Het
Npas2 T C 1: 39,287,472 S13P probably damaging Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Olfr218 T C 1: 173,203,844 S163P probably damaging Het
Olfr547 A G 7: 102,534,963 D72G probably damaging Het
Olfr703 A G 7: 106,844,923 E104G probably benign Het
Olfr806 A G 10: 129,738,185 V244A probably benign Het
Pcdh12 T C 18: 38,282,056 D672G possibly damaging Het
Pcolce2 T C 9: 95,681,647 Y229H probably damaging Het
Pga5 C T 19: 10,677,944 V10M possibly damaging Het
Phyh A G 2: 4,927,433 D110G probably benign Het
Pias1 C T 9: 62,923,637 R163H probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pole T C 5: 110,334,446 Y2051H probably damaging Het
Rbbp8 A T 18: 11,696,802 K141* probably null Het
Rin2 T A 2: 145,885,691 V827E probably damaging Het
Spatc1 A G 15: 76,292,312 Y421C probably damaging Het
Strada T C 11: 106,171,158 Y152C probably damaging Het
Top1mt A G 15: 75,669,302 V212A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Tubgcp6 C A 15: 89,102,949 G1274W possibly damaging Het
Unc79 T A 12: 103,104,639 I1231N probably damaging Het
Upp2 T C 2: 58,780,106 S275P probably damaging Het
Usp4 T A 9: 108,388,382 probably null Het
Usp47 A G 7: 112,059,001 T196A probably damaging Het
Vmn2r116 A T 17: 23,385,931 K73* probably null Het
Wdr74 T A 19: 8,737,910 H144Q probably benign Het
Zan A T 5: 137,388,938 M4951K unknown Het
Other mutations in Olfr670
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr670 APN 7 104960716 missense probably damaging 0.96
IGL01100:Olfr670 APN 7 104959995 missense probably benign 0.07
IGL01351:Olfr670 APN 7 104960739 start gained probably benign
IGL01478:Olfr670 APN 7 104960348 missense probably damaging 0.97
IGL01835:Olfr670 APN 7 104960462 missense probably benign 0.01
IGL02326:Olfr670 APN 7 104960646 missense probably benign 0.12
IGL02434:Olfr670 APN 7 104960072 missense probably benign 0.05
IGL02434:Olfr670 APN 7 104960074 nonsense probably null
IGL02968:Olfr670 APN 7 104960244 missense possibly damaging 0.90
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0345:Olfr670 UTSW 7 104960181 missense probably damaging 1.00
R0401:Olfr670 UTSW 7 104959943 missense probably damaging 1.00
R0646:Olfr670 UTSW 7 104959811 missense probably benign 0.02
R1493:Olfr670 UTSW 7 104960502 missense probably damaging 0.97
R1532:Olfr670 UTSW 7 104960265 missense probably benign
R1557:Olfr670 UTSW 7 104960540 missense probably damaging 0.99
R4072:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4074:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4075:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4076:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4229:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R4230:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R5374:Olfr670 UTSW 7 104959996 missense probably damaging 1.00
R6006:Olfr670 UTSW 7 104960663 missense probably damaging 0.99
R6891:Olfr670 UTSW 7 104959985 missense probably damaging 1.00
R7465:Olfr670 UTSW 7 104959917 missense probably benign 0.23
R8105:Olfr670 UTSW 7 104960422 missense probably benign 0.15
R8117:Olfr670 UTSW 7 104960149 missense probably damaging 1.00
R8356:Olfr670 UTSW 7 104960727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAAACCTATGTGTCATGAATG -3'
(R):5'- GCGGTACAGTCAGATTCTCACC -3'

Sequencing Primer
(F):5'- GCCACATGTGTTAAGTGC -3'
(R):5'- GGTACAGTCAGATTCTCACCAACAG -3'
Posted On2020-10-20