Incidental Mutation 'R0368:Aox4'
ID 65580
Institutional Source Beutler Lab
Gene Symbol Aox4
Ensembl Gene ENSMUSG00000038242
Gene Name aldehyde oxidase 4
Synonyms AOH2, 2310003G12Rik
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0368 (G1)
Quality Score 132
Status Not validated
Chromosome 1
Chromosomal Location 58249556-58307756 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58252238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 38 (L38F)
Ref Sequence ENSEMBL: ENSMUSP00000048929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040442]
AlphaFold Q3TYQ9
Predicted Effect probably benign
Transcript: ENSMUST00000040442
AA Change: L38F

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: L38F

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.6e-10 PFAM
Pfam:Fer2_2 91 165 4.6e-30 PFAM
Pfam:FAD_binding_5 240 421 2.7e-47 PFAM
CO_deh_flav_C 428 532 1.19e-26 SMART
Ald_Xan_dh_C 596 699 8.22e-39 SMART
Pfam:Ald_Xan_dh_C2 709 1243 1.1e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189059
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Aox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Aox4 APN 1 58,278,333 (GRCm39) missense probably damaging 1.00
IGL01011:Aox4 APN 1 58,279,934 (GRCm39) nonsense probably null
IGL01634:Aox4 APN 1 58,261,089 (GRCm39) missense possibly damaging 0.81
IGL01689:Aox4 APN 1 58,284,320 (GRCm39) splice site probably benign
IGL01874:Aox4 APN 1 58,291,243 (GRCm39) missense probably damaging 1.00
IGL02104:Aox4 APN 1 58,275,816 (GRCm39) splice site probably benign
IGL02744:Aox4 APN 1 58,294,711 (GRCm39) missense possibly damaging 0.90
IGL02751:Aox4 APN 1 58,298,211 (GRCm39) missense probably damaging 1.00
IGL03225:Aox4 APN 1 58,286,386 (GRCm39) missense possibly damaging 0.94
IGL03247:Aox4 APN 1 58,303,526 (GRCm39) missense probably damaging 1.00
IGL03369:Aox4 APN 1 58,301,746 (GRCm39) missense probably benign 0.01
BB008:Aox4 UTSW 1 58,294,645 (GRCm39) missense probably benign 0.07
BB018:Aox4 UTSW 1 58,294,645 (GRCm39) missense probably benign 0.07
R0138:Aox4 UTSW 1 58,268,025 (GRCm39) missense probably damaging 1.00
R0243:Aox4 UTSW 1 58,252,235 (GRCm39) missense probably benign
R0499:Aox4 UTSW 1 58,302,556 (GRCm39) critical splice donor site probably null
R0513:Aox4 UTSW 1 58,286,459 (GRCm39) missense probably damaging 1.00
R0513:Aox4 UTSW 1 58,256,678 (GRCm39) missense probably benign
R0546:Aox4 UTSW 1 58,289,333 (GRCm39) missense probably damaging 1.00
R0591:Aox4 UTSW 1 58,278,261 (GRCm39) splice site probably benign
R0825:Aox4 UTSW 1 58,288,068 (GRCm39) missense possibly damaging 0.55
R1912:Aox4 UTSW 1 58,303,561 (GRCm39) missense probably damaging 1.00
R1934:Aox4 UTSW 1 58,285,095 (GRCm39) missense probably benign 0.01
R2180:Aox4 UTSW 1 58,252,226 (GRCm39) missense probably benign 0.00
R2293:Aox4 UTSW 1 58,261,096 (GRCm39) missense probably damaging 0.99
R3017:Aox4 UTSW 1 58,274,363 (GRCm39) missense probably benign
R3744:Aox4 UTSW 1 58,285,029 (GRCm39) missense probably damaging 1.00
R3745:Aox4 UTSW 1 58,285,029 (GRCm39) missense probably damaging 1.00
R3830:Aox4 UTSW 1 58,294,670 (GRCm39) missense probably damaging 0.99
R3856:Aox4 UTSW 1 58,293,093 (GRCm39) missense probably damaging 1.00
R4214:Aox4 UTSW 1 58,261,051 (GRCm39) missense probably damaging 0.99
R4484:Aox4 UTSW 1 58,301,730 (GRCm39) missense probably damaging 1.00
R4706:Aox4 UTSW 1 58,305,946 (GRCm39) missense probably damaging 1.00
R4710:Aox4 UTSW 1 58,294,797 (GRCm39) missense probably damaging 1.00
R4729:Aox4 UTSW 1 58,298,236 (GRCm39) nonsense probably null
R4769:Aox4 UTSW 1 58,298,307 (GRCm39) missense probably null 1.00
R4809:Aox4 UTSW 1 58,305,808 (GRCm39) missense probably damaging 1.00
R4989:Aox4 UTSW 1 58,275,835 (GRCm39) missense probably benign 0.00
R5082:Aox4 UTSW 1 58,270,642 (GRCm39) missense possibly damaging 0.63
R5102:Aox4 UTSW 1 58,279,937 (GRCm39) missense probably damaging 1.00
R5114:Aox4 UTSW 1 58,285,445 (GRCm39) missense possibly damaging 0.89
R5133:Aox4 UTSW 1 58,275,835 (GRCm39) missense probably benign 0.00
R5134:Aox4 UTSW 1 58,275,835 (GRCm39) missense probably benign 0.00
R5185:Aox4 UTSW 1 58,293,477 (GRCm39) missense probably damaging 1.00
R5217:Aox4 UTSW 1 58,285,400 (GRCm39) nonsense probably null
R5426:Aox4 UTSW 1 58,259,253 (GRCm39) missense probably damaging 1.00
R5443:Aox4 UTSW 1 58,273,151 (GRCm39) splice site probably null
R5708:Aox4 UTSW 1 58,285,032 (GRCm39) missense possibly damaging 0.69
R6052:Aox4 UTSW 1 58,293,477 (GRCm39) nonsense probably null
R6167:Aox4 UTSW 1 58,303,094 (GRCm39) missense probably damaging 1.00
R6179:Aox4 UTSW 1 58,270,662 (GRCm39) missense probably benign
R6196:Aox4 UTSW 1 58,256,685 (GRCm39) missense probably damaging 1.00
R6513:Aox4 UTSW 1 58,252,212 (GRCm39) missense probably benign 0.01
R6781:Aox4 UTSW 1 58,284,268 (GRCm39) missense probably benign 0.03
R6885:Aox4 UTSW 1 58,303,537 (GRCm39) missense probably damaging 1.00
R7082:Aox4 UTSW 1 58,263,352 (GRCm39) missense possibly damaging 0.82
R7127:Aox4 UTSW 1 58,268,033 (GRCm39) missense probably benign 0.00
R7153:Aox4 UTSW 1 58,289,378 (GRCm39) missense probably damaging 0.99
R7371:Aox4 UTSW 1 58,303,013 (GRCm39) missense probably damaging 1.00
R7690:Aox4 UTSW 1 58,303,076 (GRCm39) missense probably damaging 1.00
R7745:Aox4 UTSW 1 58,279,866 (GRCm39) missense probably benign 0.01
R7752:Aox4 UTSW 1 58,293,107 (GRCm39) missense not run
R7767:Aox4 UTSW 1 58,274,366 (GRCm39) missense probably damaging 0.98
R7782:Aox4 UTSW 1 58,270,251 (GRCm39) splice site probably null
R7931:Aox4 UTSW 1 58,294,645 (GRCm39) missense probably benign 0.07
R7978:Aox4 UTSW 1 58,274,366 (GRCm39) missense probably damaging 0.98
R7982:Aox4 UTSW 1 58,296,400 (GRCm39) missense possibly damaging 0.81
R8316:Aox4 UTSW 1 58,293,470 (GRCm39) missense possibly damaging 0.69
R8361:Aox4 UTSW 1 58,279,998 (GRCm39) missense probably benign 0.03
R8829:Aox4 UTSW 1 58,294,649 (GRCm39) missense probably benign 0.01
R8832:Aox4 UTSW 1 58,294,649 (GRCm39) missense probably benign 0.01
R8896:Aox4 UTSW 1 58,291,233 (GRCm39) missense probably benign
R9103:Aox4 UTSW 1 58,296,441 (GRCm39) missense probably damaging 1.00
R9241:Aox4 UTSW 1 58,291,345 (GRCm39) missense probably damaging 1.00
R9282:Aox4 UTSW 1 58,285,028 (GRCm39) missense possibly damaging 0.59
R9487:Aox4 UTSW 1 58,288,097 (GRCm39) missense probably benign 0.00
R9493:Aox4 UTSW 1 58,286,434 (GRCm39) missense probably benign 0.01
R9557:Aox4 UTSW 1 58,285,095 (GRCm39) missense probably benign 0.00
R9616:Aox4 UTSW 1 58,268,020 (GRCm39) missense possibly damaging 0.81
R9644:Aox4 UTSW 1 58,267,278 (GRCm39) missense probably benign 0.01
R9683:Aox4 UTSW 1 58,278,462 (GRCm39) critical splice donor site probably null
R9727:Aox4 UTSW 1 58,286,473 (GRCm39) missense probably benign 0.43
R9767:Aox4 UTSW 1 58,274,357 (GRCm39) missense probably benign 0.05
X0021:Aox4 UTSW 1 58,286,454 (GRCm39) nonsense probably null
X0028:Aox4 UTSW 1 58,293,342 (GRCm39) missense probably damaging 0.99
Z1176:Aox4 UTSW 1 58,285,510 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CGGTCCTTTCCAGGTAAATGCTTATCC -3'
(R):5'- ACGCAGGTGGCTTTCCTTTCAT -3'

Sequencing Primer
(F):5'- AAAACGTCACTGTTTCTTCAGACC -3'
(R):5'- ctgtctgtctgtctgtctgtc -3'
Posted On 2013-08-08