Mutagenetix > Incidental Mutation

Incidental Mutation 'R0368:Aox4'

65580

Institutional Source

Beutler Lab

Gene Symbol

Aox4

Ensembl Gene

ENSMUSG00000038242

Gene Name

aldehyde oxidase 4

Synonyms

2310003G12Rik, AOH2

MMRRC Submission

038574-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0368 (G1)

Quality Score

132

Status

Not validated

Chromosome

Chromosomal Location

58210397-58268597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58213079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 38 (L38F)

Ref Sequence

ENSEMBL: ENSMUSP00000048929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040442]

AlphaFold

Q3TYQ9

Predicted Effect

probably benign
Transcript: ENSMUST00000040442
AA Change: L38F

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: L38F

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.6e-10	PFAM
Pfam:Fer2_2	91	165	4.6e-30	PFAM
Pfam:FAD_binding_5	240	421	2.7e-47	PFAM
CO_deh_flav_C	428	532	1.19e-26	SMART
Ald_Xan_dh_C	596	699	8.22e-39	SMART
Pfam:Ald_Xan_dh_C2	709	1243	1.1e-178	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159240

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161833

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189059

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	T	19: 9,008,350	K2333*	probably null	Het
Arhgef15	T	C	11: 68,954,693	E111G	probably damaging	Het
Atp8a2	A	T	14: 59,860,212	I789N	probably damaging	Het
Cdca2	A	G	14: 67,700,347	S286P	possibly damaging	Het
Chrnb1	T	A	11: 69,784,757	K457M	probably damaging	Het
Clec2g	A	G	6: 128,980,261	I61V	possibly damaging	Het
Cyb5r3	G	A	15: 83,158,792	A233V	probably benign	Het
Cyp4a10	T	A	4: 115,525,377	L278*	probably null	Het
Dnmt1	T	C	9: 20,941,757	E56G	probably damaging	Het
Fam160b1	A	G	19: 57,368,578	T34A	possibly damaging	Het
Fam166a	T	A	2: 25,220,673	D164E	probably benign	Het
Fbln5	A	G	12: 101,809,714		probably null	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gabrr3	A	G	16: 59,440,596	D289G	probably damaging	Het
Gpr45	T	C	1: 43,033,016	L273P	probably damaging	Het
Hkdc1	T	C	10: 62,411,707	E125G	probably null	Het
Il25	A	G	14: 54,935,174		probably null	Het
Itfg1	A	T	8: 85,764,407	W298R	probably damaging	Het
Kank1	A	T	19: 25,410,603	K547*	probably null	Het
Lama5	G	A	2: 180,181,230	R2748*	probably null	Het
Lrp4	C	T	2: 91,477,734	T508I	probably damaging	Het
Map3k10	C	T	7: 27,663,360	V434I	probably damaging	Het
Map3k6	A	G	4: 133,252,659	M1265V	probably benign	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Msh4	T	A	3: 153,888,825	Y113F	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nrip1	A	G	16: 76,294,016	S218P	probably damaging	Het
Olfr1281	T	C	2: 111,328,787	Y123H	probably damaging	Het
Olfr1287	T	C	2: 111,449,788	I216T	probably benign	Het
Olig1	C	T	16: 91,270,652	S259F	probably damaging	Het
Osbpl9	A	G	4: 109,066,932	V499A	probably damaging	Het
Pafah2	T	C	4: 134,422,491	V371A	probably benign	Het
Pkp1	T	A	1: 135,875,683	M712L	probably benign	Het
Pkp1	T	C	1: 135,886,852	S244G	probably benign	Het
Ppp1r3a	T	C	6: 14,718,960	T652A	probably benign	Het
Rab21	A	T	10: 115,298,890	V108E	probably damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Scd2	G	A	19: 44,301,246	V227I	probably benign	Het
Sema5b	T	A	16: 35,628,100	V82E	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc13a2	A	T	11: 78,404,800	L80*	probably null	Het
Slc1a5	C	T	7: 16,782,178	P93L	probably damaging	Het
Slc35b2	T	C	17: 45,566,463	V172A	probably benign	Het
Slfn8	A	G	11: 83,017,132	L195P	probably damaging	Het
Smox	G	A	2: 131,522,158	S320N	probably damaging	Het
Sptan1	T	C	2: 29,993,915	V589A	probably benign	Het
Stim2	G	A	5: 54,110,140		probably null	Het
V1ra8	A	G	6: 90,202,962	D49G	probably damaging	Het
Vmn1r233	A	T	17: 20,994,607	V27D	possibly damaging	Het
Vmn2r98	A	T	17: 19,065,827	K196*	probably null	Het
Wdr77	T	C	3: 105,962,066		probably null	Het

Other mutations in Aox4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Aox4	APN	1	58239174	missense	probably damaging	1.00
IGL01011:Aox4	APN	1	58240775	nonsense	probably null
IGL01634:Aox4	APN	1	58221930	missense	possibly damaging	0.81
IGL01689:Aox4	APN	1	58245161	splice site	probably benign
IGL01874:Aox4	APN	1	58252084	missense	probably damaging	1.00
IGL02104:Aox4	APN	1	58236657	splice site	probably benign
IGL02744:Aox4	APN	1	58255552	missense	possibly damaging	0.90
IGL02751:Aox4	APN	1	58259052	missense	probably damaging	1.00
IGL03225:Aox4	APN	1	58247227	missense	possibly damaging	0.94
IGL03247:Aox4	APN	1	58264367	missense	probably damaging	1.00
IGL03369:Aox4	APN	1	58262587	missense	probably benign	0.01
BB008:Aox4	UTSW	1	58255486	missense	probably benign	0.07
BB018:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R0138:Aox4	UTSW	1	58228866	missense	probably damaging	1.00
R0243:Aox4	UTSW	1	58213076	missense	probably benign
R0499:Aox4	UTSW	1	58263397	critical splice donor site	probably null
R0513:Aox4	UTSW	1	58217519	missense	probably benign
R0513:Aox4	UTSW	1	58247300	missense	probably damaging	1.00
R0546:Aox4	UTSW	1	58250174	missense	probably damaging	1.00
R0591:Aox4	UTSW	1	58239102	splice site	probably benign
R0825:Aox4	UTSW	1	58248909	missense	possibly damaging	0.55
R1912:Aox4	UTSW	1	58264402	missense	probably damaging	1.00
R1934:Aox4	UTSW	1	58245936	missense	probably benign	0.01
R2180:Aox4	UTSW	1	58213067	missense	probably benign	0.00
R2293:Aox4	UTSW	1	58221937	missense	probably damaging	0.99
R3017:Aox4	UTSW	1	58235204	missense	probably benign
R3744:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3745:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3830:Aox4	UTSW	1	58255511	missense	probably damaging	0.99
R3856:Aox4	UTSW	1	58253934	missense	probably damaging	1.00
R4214:Aox4	UTSW	1	58221892	missense	probably damaging	0.99
R4484:Aox4	UTSW	1	58262571	missense	probably damaging	1.00
R4706:Aox4	UTSW	1	58266787	missense	probably damaging	1.00
R4710:Aox4	UTSW	1	58255638	missense	probably damaging	1.00
R4729:Aox4	UTSW	1	58259077	nonsense	probably null
R4769:Aox4	UTSW	1	58259148	missense	probably null	1.00
R4809:Aox4	UTSW	1	58266649	missense	probably damaging	1.00
R4989:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5082:Aox4	UTSW	1	58231483	missense	possibly damaging	0.63
R5102:Aox4	UTSW	1	58240778	missense	probably damaging	1.00
R5114:Aox4	UTSW	1	58246286	missense	possibly damaging	0.89
R5133:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5134:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5185:Aox4	UTSW	1	58254318	missense	probably damaging	1.00
R5217:Aox4	UTSW	1	58246241	nonsense	probably null
R5426:Aox4	UTSW	1	58220094	missense	probably damaging	1.00
R5443:Aox4	UTSW	1	58233992	splice site	probably null
R5708:Aox4	UTSW	1	58245873	missense	possibly damaging	0.69
R6052:Aox4	UTSW	1	58254318	nonsense	probably null
R6167:Aox4	UTSW	1	58263935	missense	probably damaging	1.00
R6179:Aox4	UTSW	1	58231503	missense	probably benign
R6196:Aox4	UTSW	1	58217526	missense	probably damaging	1.00
R6513:Aox4	UTSW	1	58213053	missense	probably benign	0.01
R6781:Aox4	UTSW	1	58245109	missense	probably benign	0.03
R6885:Aox4	UTSW	1	58264378	missense	probably damaging	1.00
R7082:Aox4	UTSW	1	58224193	missense	possibly damaging	0.82
R7127:Aox4	UTSW	1	58228874	missense	probably benign	0.00
R7153:Aox4	UTSW	1	58250219	missense	probably damaging	0.99
R7371:Aox4	UTSW	1	58263854	missense	probably damaging	1.00
R7690:Aox4	UTSW	1	58263917	missense	probably damaging	1.00
R7745:Aox4	UTSW	1	58240707	missense	probably benign	0.01
R7752:Aox4	UTSW	1	58253948	missense	not run
R7767:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7782:Aox4	UTSW	1	58231092	splice site	probably null
R7931:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R7978:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7982:Aox4	UTSW	1	58257241	missense	possibly damaging	0.81
R8316:Aox4	UTSW	1	58254311	missense	possibly damaging	0.69
R8361:Aox4	UTSW	1	58240839	missense	probably benign	0.03
R8829:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8832:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8896:Aox4	UTSW	1	58252074	missense	probably benign
R9103:Aox4	UTSW	1	58257282	missense	probably damaging	1.00
R9241:Aox4	UTSW	1	58252186	missense	probably damaging	1.00
R9282:Aox4	UTSW	1	58245869	missense	possibly damaging	0.59
R9487:Aox4	UTSW	1	58248938	missense	probably benign	0.00
R9493:Aox4	UTSW	1	58247275	missense	probably benign	0.01
R9557:Aox4	UTSW	1	58245936	missense	probably benign	0.00
R9616:Aox4	UTSW	1	58228861	missense	possibly damaging	0.81
R9644:Aox4	UTSW	1	58228119	missense	probably benign	0.01
R9683:Aox4	UTSW	1	58239303	critical splice donor site	probably null
R9727:Aox4	UTSW	1	58247314	missense	probably benign	0.43
R9767:Aox4	UTSW	1	58235198	missense	probably benign	0.05
X0021:Aox4	UTSW	1	58247295	nonsense	probably null
X0028:Aox4	UTSW	1	58254183	missense	probably damaging	0.99
Z1176:Aox4	UTSW	1	58246351	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- CGGTCCTTTCCAGGTAAATGCTTATCC -3'
(R):5'- ACGCAGGTGGCTTTCCTTTCAT -3'

Sequencing Primer
(F):5'- AAAACGTCACTGTTTCTTCAGACC -3'
(R):5'- ctgtctgtctgtctgtctgtc -3'

Posted On

2013-08-08