Incidental Mutation 'R8510:Usp47'
ID655800
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R8510 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112059001 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 196 (T196A)
Ref Sequence ENSEMBL: ENSMUSP00000147619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably damaging
Transcript: ENSMUST00000106653
AA Change: T176A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: T176A

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210309
AA Change: T196A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215510
AA Change: T176A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A T 17: 42,719,540 C9* probably null Het
Avil A G 10: 127,009,781 N331S probably benign Het
Casp1 G A 9: 5,303,026 R160H probably damaging Het
Celsr3 T C 9: 108,838,120 F2105L possibly damaging Het
Cenpf A T 1: 189,650,706 S2664T probably benign Het
Cfap221 T A 1: 119,989,447 K75* probably null Het
Cmtr2 T C 8: 110,222,435 V459A possibly damaging Het
Col5a3 A T 9: 20,793,732 D740E unknown Het
Crybg2 C A 4: 134,073,359 A301E probably benign Het
Cwf19l2 A G 9: 3,454,732 I682V possibly damaging Het
Dach1 T C 14: 97,903,159 D521G probably damaging Het
Dync1h1 T A 12: 110,616,743 Y425N possibly damaging Het
Emc3 G T 6: 113,531,389 H32N probably damaging Het
Exosc10 T C 4: 148,564,189 L304P probably damaging Het
Fam160b1 A T 19: 57,382,320 K557I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gldc T A 19: 30,116,505 Y704F probably damaging Het
Gm11077 A G 6: 140,729,306 N8S unknown Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gm906 T C 13: 50,250,192 M25V probably benign Het
Gpam A G 19: 55,080,382 probably null Het
Gss G A 2: 155,567,824 Q300* probably null Het
Hydin T A 8: 110,506,570 L1767H probably damaging Het
Igf2r A G 17: 12,704,313 V1203A probably benign Het
Kcnf1 T A 12: 17,175,938 D94V probably damaging Het
Kif18a T A 2: 109,296,764 Y348N probably damaging Het
Klc4 G A 17: 46,644,304 A68V possibly damaging Het
Lhx4 G T 1: 155,702,301 T365K probably damaging Het
Mid1 A G X: 169,985,023 E389G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myo1e C T 9: 70,335,265 A354V probably damaging Het
Ncoa1 T C 12: 4,259,303 N1331S probably benign Het
Npas2 T C 1: 39,287,472 S13P probably damaging Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Olfr218 T C 1: 173,203,844 S163P probably damaging Het
Olfr547 A G 7: 102,534,963 D72G probably damaging Het
Olfr670 G T 7: 104,960,114 S206* probably null Het
Olfr703 A G 7: 106,844,923 E104G probably benign Het
Olfr806 A G 10: 129,738,185 V244A probably benign Het
Pcdh12 T C 18: 38,282,056 D672G possibly damaging Het
Pcolce2 T C 9: 95,681,647 Y229H probably damaging Het
Pga5 C T 19: 10,677,944 V10M possibly damaging Het
Phyh A G 2: 4,927,433 D110G probably benign Het
Pias1 C T 9: 62,923,637 R163H probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pole T C 5: 110,334,446 Y2051H probably damaging Het
Rbbp8 A T 18: 11,696,802 K141* probably null Het
Rin2 T A 2: 145,885,691 V827E probably damaging Het
Spatc1 A G 15: 76,292,312 Y421C probably damaging Het
Strada T C 11: 106,171,158 Y152C probably damaging Het
Top1mt A G 15: 75,669,302 V212A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Tubgcp6 C A 15: 89,102,949 G1274W possibly damaging Het
Unc79 T A 12: 103,104,639 I1231N probably damaging Het
Upp2 T C 2: 58,780,106 S275P probably damaging Het
Usp4 T A 9: 108,388,382 probably null Het
Vmn2r116 A T 17: 23,385,931 K73* probably null Het
Wdr74 T A 19: 8,737,910 H144Q probably benign Het
Zan A T 5: 137,388,938 M4951K unknown Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
0152:Usp47 UTSW 7 112056577 missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1447:Usp47 UTSW 7 112074568 critical splice donor site probably null
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2504:Usp47 UTSW 7 112104470 critical splice donor site probably null
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4179:Usp47 UTSW 7 112087884 missense probably damaging 1.00
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4281:Usp47 UTSW 7 112109993 missense probably benign 0.03
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R6271:Usp47 UTSW 7 112087056 missense probably damaging 1.00
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
R7246:Usp47 UTSW 7 112115909
R7285:Usp47 UTSW 7 112093108 missense probably benign 0.02
R7938:Usp47 UTSW 7 112087925 missense probably damaging 0.99
R8079:Usp47 UTSW 7 112046970 missense probably damaging 1.00
R8114:Usp47 UTSW 7 112093187 missense probably damaging 1.00
R8141:Usp47 UTSW 7 112053265 missense possibly damaging 0.60
R8172:Usp47 UTSW 7 112087926 nonsense probably null
R8223:Usp47 UTSW 7 112104376 missense probably damaging 1.00
RF010:Usp47 UTSW 7 112092938 missense probably damaging 0.99
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGCTTTCTTAAGTGGCATTG -3'
(R):5'- CTTTTATGTCAGTCTTTCGGTAGAC -3'

Sequencing Primer
(F):5'- GTGTTTTAGCCCAAGTGC -3'
(R):5'- CAGGAAGTCAGCTTATAAAGTAAG -3'
Posted On2020-10-20