Incidental Mutation 'R8510:Igf2r'
ID655829
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Nameinsulin-like growth factor 2 receptor
SynonymsM6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R8510 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location12682406-12769664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12704313 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1203 (V1203A)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
Predicted Effect probably benign
Transcript: ENSMUST00000024599
AA Change: V1203A

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: V1203A

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161738
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A T 17: 42,719,540 C9* probably null Het
Avil A G 10: 127,009,781 N331S probably benign Het
Casp1 G A 9: 5,303,026 R160H probably damaging Het
Celsr3 T C 9: 108,838,120 F2105L possibly damaging Het
Cenpf A T 1: 189,650,706 S2664T probably benign Het
Cfap221 T A 1: 119,989,447 K75* probably null Het
Cmtr2 T C 8: 110,222,435 V459A possibly damaging Het
Col5a3 A T 9: 20,793,732 D740E unknown Het
Crybg2 C A 4: 134,073,359 A301E probably benign Het
Cwf19l2 A G 9: 3,454,732 I682V possibly damaging Het
Dach1 T C 14: 97,903,159 D521G probably damaging Het
Dync1h1 T A 12: 110,616,743 Y425N possibly damaging Het
Emc3 G T 6: 113,531,389 H32N probably damaging Het
Exosc10 T C 4: 148,564,189 L304P probably damaging Het
Fam160b1 A T 19: 57,382,320 K557I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gldc T A 19: 30,116,505 Y704F probably damaging Het
Gm11077 A G 6: 140,729,306 N8S unknown Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gm906 T C 13: 50,250,192 M25V probably benign Het
Gpam A G 19: 55,080,382 probably null Het
Gss G A 2: 155,567,824 Q300* probably null Het
Hydin T A 8: 110,506,570 L1767H probably damaging Het
Kcnf1 T A 12: 17,175,938 D94V probably damaging Het
Kif18a T A 2: 109,296,764 Y348N probably damaging Het
Klc4 G A 17: 46,644,304 A68V possibly damaging Het
Lhx4 G T 1: 155,702,301 T365K probably damaging Het
Mid1 A G X: 169,985,023 E389G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myo1e C T 9: 70,335,265 A354V probably damaging Het
Ncoa1 T C 12: 4,259,303 N1331S probably benign Het
Npas2 T C 1: 39,287,472 S13P probably damaging Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Olfr218 T C 1: 173,203,844 S163P probably damaging Het
Olfr547 A G 7: 102,534,963 D72G probably damaging Het
Olfr670 G T 7: 104,960,114 S206* probably null Het
Olfr703 A G 7: 106,844,923 E104G probably benign Het
Olfr806 A G 10: 129,738,185 V244A probably benign Het
Pcdh12 T C 18: 38,282,056 D672G possibly damaging Het
Pcolce2 T C 9: 95,681,647 Y229H probably damaging Het
Pga5 C T 19: 10,677,944 V10M possibly damaging Het
Phyh A G 2: 4,927,433 D110G probably benign Het
Pias1 C T 9: 62,923,637 R163H probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pole T C 5: 110,334,446 Y2051H probably damaging Het
Rbbp8 A T 18: 11,696,802 K141* probably null Het
Rin2 T A 2: 145,885,691 V827E probably damaging Het
Spatc1 A G 15: 76,292,312 Y421C probably damaging Het
Strada T C 11: 106,171,158 Y152C probably damaging Het
Top1mt A G 15: 75,669,302 V212A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Tubgcp6 C A 15: 89,102,949 G1274W possibly damaging Het
Unc79 T A 12: 103,104,639 I1231N probably damaging Het
Upp2 T C 2: 58,780,106 S275P probably damaging Het
Usp4 T A 9: 108,388,382 probably null Het
Usp47 A G 7: 112,059,001 T196A probably damaging Het
Vmn2r116 A T 17: 23,385,931 K73* probably null Het
Wdr74 T A 19: 8,737,910 H144Q probably benign Het
Zan A T 5: 137,388,938 M4951K unknown Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
R5473_Igf2r_949 UTSW 17 12695314 missense probably benign 0.20
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 splice site probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
R7619:Igf2r UTSW 17 12698273 missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12735991 missense probably damaging 0.98
R7733:Igf2r UTSW 17 12739369 missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12748704 missense probably benign
R8022:Igf2r UTSW 17 12718795 missense probably damaging 1.00
R8138:Igf2r UTSW 17 12701238 missense probably benign 0.32
R8220:Igf2r UTSW 17 12692071 missense probably benign 0.22
R8305:Igf2r UTSW 17 12733860 missense probably benign
R8359:Igf2r UTSW 17 12683861 missense probably benign
R8500:Igf2r UTSW 17 12709441 missense probably damaging 0.99
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Z1177:Igf2r UTSW 17 12697399 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCCATCCTGACTGCTTTAC -3'
(R):5'- CAGGCTTATAATCGTCCGTCAG -3'

Sequencing Primer
(F):5'- CAAGTGGCTTAATAAAGACCTCAAG -3'
(R):5'- AGTACTGAACCCTTGGCTTAAGCG -3'
Posted On2020-10-20