Incidental Mutation 'R8510:Vmn2r116'
ID655830
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Namevomeronasal 2, receptor 116
SynonymsV2Rp5, EG619697
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8510 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23384803-23401864 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 23385931 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 73 (K73*)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
Predicted Effect probably null
Transcript: ENSMUST00000164856
AA Change: K73*
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: K73*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A T 17: 42,719,540 C9* probably null Het
Avil A G 10: 127,009,781 N331S probably benign Het
Casp1 G A 9: 5,303,026 R160H probably damaging Het
Celsr3 T C 9: 108,838,120 F2105L possibly damaging Het
Cenpf A T 1: 189,650,706 S2664T probably benign Het
Cfap221 T A 1: 119,989,447 K75* probably null Het
Cmtr2 T C 8: 110,222,435 V459A possibly damaging Het
Col5a3 A T 9: 20,793,732 D740E unknown Het
Crybg2 C A 4: 134,073,359 A301E probably benign Het
Cwf19l2 A G 9: 3,454,732 I682V possibly damaging Het
Dach1 T C 14: 97,903,159 D521G probably damaging Het
Dync1h1 T A 12: 110,616,743 Y425N possibly damaging Het
Emc3 G T 6: 113,531,389 H32N probably damaging Het
Exosc10 T C 4: 148,564,189 L304P probably damaging Het
Fam160b1 A T 19: 57,382,320 K557I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gldc T A 19: 30,116,505 Y704F probably damaging Het
Gm11077 A G 6: 140,729,306 N8S unknown Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gm906 T C 13: 50,250,192 M25V probably benign Het
Gpam A G 19: 55,080,382 probably null Het
Gss G A 2: 155,567,824 Q300* probably null Het
Hydin T A 8: 110,506,570 L1767H probably damaging Het
Igf2r A G 17: 12,704,313 V1203A probably benign Het
Kcnf1 T A 12: 17,175,938 D94V probably damaging Het
Kif18a T A 2: 109,296,764 Y348N probably damaging Het
Klc4 G A 17: 46,644,304 A68V possibly damaging Het
Lhx4 G T 1: 155,702,301 T365K probably damaging Het
Mid1 A G X: 169,985,023 E389G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myo1e C T 9: 70,335,265 A354V probably damaging Het
Ncoa1 T C 12: 4,259,303 N1331S probably benign Het
Npas2 T C 1: 39,287,472 S13P probably damaging Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Olfr218 T C 1: 173,203,844 S163P probably damaging Het
Olfr547 A G 7: 102,534,963 D72G probably damaging Het
Olfr670 G T 7: 104,960,114 S206* probably null Het
Olfr703 A G 7: 106,844,923 E104G probably benign Het
Olfr806 A G 10: 129,738,185 V244A probably benign Het
Pcdh12 T C 18: 38,282,056 D672G possibly damaging Het
Pcolce2 T C 9: 95,681,647 Y229H probably damaging Het
Pga5 C T 19: 10,677,944 V10M possibly damaging Het
Phyh A G 2: 4,927,433 D110G probably benign Het
Pias1 C T 9: 62,923,637 R163H probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pole T C 5: 110,334,446 Y2051H probably damaging Het
Rbbp8 A T 18: 11,696,802 K141* probably null Het
Rin2 T A 2: 145,885,691 V827E probably damaging Het
Spatc1 A G 15: 76,292,312 Y421C probably damaging Het
Strada T C 11: 106,171,158 Y152C probably damaging Het
Top1mt A G 15: 75,669,302 V212A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Tubgcp6 C A 15: 89,102,949 G1274W possibly damaging Het
Unc79 T A 12: 103,104,639 I1231N probably damaging Het
Upp2 T C 2: 58,780,106 S275P probably damaging Het
Usp4 T A 9: 108,388,382 probably null Het
Usp47 A G 7: 112,059,001 T196A probably damaging Het
Wdr74 T A 19: 8,737,910 H144Q probably benign Het
Zan A T 5: 137,388,938 M4951K unknown Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGTTTTATGAACTTCCAGCTTC -3'
(R):5'- CCAATTCATGTTTGTAAGGGCC -3'

Sequencing Primer
(F):5'- CTTTGTCATCTCAACCACATTACAC -3'
(R):5'- CATGTTTGTAAGGGCCAGTATAC -3'
Posted On2020-10-20