Incidental Mutation 'R8510:Pcdh12'
ID655834
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8510 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38282056 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 672 (D672G)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025311
AA Change: D672G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: D672G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A T 17: 42,719,540 C9* probably null Het
Avil A G 10: 127,009,781 N331S probably benign Het
Casp1 G A 9: 5,303,026 R160H probably damaging Het
Celsr3 T C 9: 108,838,120 F2105L possibly damaging Het
Cenpf A T 1: 189,650,706 S2664T probably benign Het
Cfap221 T A 1: 119,989,447 K75* probably null Het
Cmtr2 T C 8: 110,222,435 V459A possibly damaging Het
Col5a3 A T 9: 20,793,732 D740E unknown Het
Crybg2 C A 4: 134,073,359 A301E probably benign Het
Cwf19l2 A G 9: 3,454,732 I682V possibly damaging Het
Dach1 T C 14: 97,903,159 D521G probably damaging Het
Dync1h1 T A 12: 110,616,743 Y425N possibly damaging Het
Emc3 G T 6: 113,531,389 H32N probably damaging Het
Exosc10 T C 4: 148,564,189 L304P probably damaging Het
Fam160b1 A T 19: 57,382,320 K557I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gldc T A 19: 30,116,505 Y704F probably damaging Het
Gm11077 A G 6: 140,729,306 N8S unknown Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gm906 T C 13: 50,250,192 M25V probably benign Het
Gpam A G 19: 55,080,382 probably null Het
Gss G A 2: 155,567,824 Q300* probably null Het
Hydin T A 8: 110,506,570 L1767H probably damaging Het
Igf2r A G 17: 12,704,313 V1203A probably benign Het
Kcnf1 T A 12: 17,175,938 D94V probably damaging Het
Kif18a T A 2: 109,296,764 Y348N probably damaging Het
Klc4 G A 17: 46,644,304 A68V possibly damaging Het
Lhx4 G T 1: 155,702,301 T365K probably damaging Het
Mid1 A G X: 169,985,023 E389G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myo1e C T 9: 70,335,265 A354V probably damaging Het
Ncoa1 T C 12: 4,259,303 N1331S probably benign Het
Npas2 T C 1: 39,287,472 S13P probably damaging Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Olfr218 T C 1: 173,203,844 S163P probably damaging Het
Olfr547 A G 7: 102,534,963 D72G probably damaging Het
Olfr670 G T 7: 104,960,114 S206* probably null Het
Olfr703 A G 7: 106,844,923 E104G probably benign Het
Olfr806 A G 10: 129,738,185 V244A probably benign Het
Pcolce2 T C 9: 95,681,647 Y229H probably damaging Het
Pga5 C T 19: 10,677,944 V10M possibly damaging Het
Phyh A G 2: 4,927,433 D110G probably benign Het
Pias1 C T 9: 62,923,637 R163H probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pole T C 5: 110,334,446 Y2051H probably damaging Het
Rbbp8 A T 18: 11,696,802 K141* probably null Het
Rin2 T A 2: 145,885,691 V827E probably damaging Het
Spatc1 A G 15: 76,292,312 Y421C probably damaging Het
Strada T C 11: 106,171,158 Y152C probably damaging Het
Top1mt A G 15: 75,669,302 V212A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Tubgcp6 C A 15: 89,102,949 G1274W possibly damaging Het
Unc79 T A 12: 103,104,639 I1231N probably damaging Het
Upp2 T C 2: 58,780,106 S275P probably damaging Het
Usp4 T A 9: 108,388,382 probably null Het
Usp47 A G 7: 112,059,001 T196A probably damaging Het
Vmn2r116 A T 17: 23,385,931 K73* probably null Het
Wdr74 T A 19: 8,737,910 H144Q probably benign Het
Zan A T 5: 137,388,938 M4951K unknown Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
R8103:Pcdh12 UTSW 18 38282159 missense probably damaging 1.00
R8157:Pcdh12 UTSW 18 38282797 missense probably benign
R8322:Pcdh12 UTSW 18 38281577 nonsense probably null
R8503:Pcdh12 UTSW 18 38282521 missense possibly damaging 0.86
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGATGGCCAGCAGTACAGC -3'
(R):5'- TGAGAATCCCAGTGGCATGG -3'

Sequencing Primer
(F):5'- GCAGTACAGCCAGGCAGATC -3'
(R):5'- AATCCCAGTGGCATGGATCCAG -3'
Posted On2020-10-20