Incidental Mutation 'R8510:Mid1'
ID655840
Institutional Source Beutler Lab
Gene Symbol Mid1
Ensembl Gene ENSMUSG00000035299
Gene Namemidline 1
Synonyms61B3-R, Trim18, DXHXS1141, Fxy
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8510 (G1)
Quality Score197.009
Status Not validated
ChromosomeX
Chromosomal Location169685199-170005736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 169985023 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 389 (E389G)
Ref Sequence ENSEMBL: ENSMUSP00000038765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036753] [ENSMUST00000078947] [ENSMUST00000079443] [ENSMUST00000112104] [ENSMUST00000112105] [ENSMUST00000112107] [ENSMUST00000163810] [ENSMUST00000171433]
Predicted Effect probably benign
Transcript: ENSMUST00000036753
AA Change: E389G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000038765
Gene: ENSMUSG00000035299
AA Change: E389G

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078947
AA Change: E351G

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077974
Gene: ENSMUSG00000035299
AA Change: E351G

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBC 181 307 1.47e-15 SMART
FN3 343 447 1.53e-6 SMART
Pfam:PRY 461 510 2.6e-11 PFAM
SPRY 513 632 1.12e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079443
AA Change: E122G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078412
Gene: ENSMUSG00000035299
AA Change: E122G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:BBC 21 78 1e-29 BLAST
FN3 114 205 1.91e-7 SMART
Pfam:PRY 219 268 5.1e-11 PFAM
SPRY 271 390 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112104
AA Change: E389G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107732
Gene: ENSMUSG00000035299
AA Change: E389G

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112105
AA Change: E389G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107733
Gene: ENSMUSG00000035299
AA Change: E389G

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 9.4e-12 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112107
AA Change: E183G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107735
Gene: ENSMUSG00000035299
AA Change: E183G

DomainStartEndE-ValueType
BBC 13 139 5.05e-14 SMART
FN3 175 279 1.53e-6 SMART
Pfam:PRY 293 342 1.7e-11 PFAM
SPRY 345 464 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163810
AA Change: E389G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128176
Gene: ENSMUSG00000035299
AA Change: E389G

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171433
AA Change: E389G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126746
Gene: ENSMUSG00000035299
AA Change: E389G

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous or hemizygous for disruptions in this gene have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A T 17: 42,719,540 C9* probably null Het
Avil A G 10: 127,009,781 N331S probably benign Het
Casp1 G A 9: 5,303,026 R160H probably damaging Het
Celsr3 T C 9: 108,838,120 F2105L possibly damaging Het
Cenpf A T 1: 189,650,706 S2664T probably benign Het
Cfap221 T A 1: 119,989,447 K75* probably null Het
Cmtr2 T C 8: 110,222,435 V459A possibly damaging Het
Col5a3 A T 9: 20,793,732 D740E unknown Het
Crybg2 C A 4: 134,073,359 A301E probably benign Het
Cwf19l2 A G 9: 3,454,732 I682V possibly damaging Het
Dach1 T C 14: 97,903,159 D521G probably damaging Het
Dync1h1 T A 12: 110,616,743 Y425N possibly damaging Het
Emc3 G T 6: 113,531,389 H32N probably damaging Het
Exosc10 T C 4: 148,564,189 L304P probably damaging Het
Fam160b1 A T 19: 57,382,320 K557I probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gldc T A 19: 30,116,505 Y704F probably damaging Het
Gm11077 A G 6: 140,729,306 N8S unknown Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gm906 T C 13: 50,250,192 M25V probably benign Het
Gpam A G 19: 55,080,382 probably null Het
Gss G A 2: 155,567,824 Q300* probably null Het
Hydin T A 8: 110,506,570 L1767H probably damaging Het
Igf2r A G 17: 12,704,313 V1203A probably benign Het
Kcnf1 T A 12: 17,175,938 D94V probably damaging Het
Kif18a T A 2: 109,296,764 Y348N probably damaging Het
Klc4 G A 17: 46,644,304 A68V possibly damaging Het
Lhx4 G T 1: 155,702,301 T365K probably damaging Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myo1e C T 9: 70,335,265 A354V probably damaging Het
Ncoa1 T C 12: 4,259,303 N1331S probably benign Het
Npas2 T C 1: 39,287,472 S13P probably damaging Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Olfr218 T C 1: 173,203,844 S163P probably damaging Het
Olfr547 A G 7: 102,534,963 D72G probably damaging Het
Olfr670 G T 7: 104,960,114 S206* probably null Het
Olfr703 A G 7: 106,844,923 E104G probably benign Het
Olfr806 A G 10: 129,738,185 V244A probably benign Het
Pcdh12 T C 18: 38,282,056 D672G possibly damaging Het
Pcolce2 T C 9: 95,681,647 Y229H probably damaging Het
Pga5 C T 19: 10,677,944 V10M possibly damaging Het
Phyh A G 2: 4,927,433 D110G probably benign Het
Pias1 C T 9: 62,923,637 R163H probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pole T C 5: 110,334,446 Y2051H probably damaging Het
Rbbp8 A T 18: 11,696,802 K141* probably null Het
Rin2 T A 2: 145,885,691 V827E probably damaging Het
Spatc1 A G 15: 76,292,312 Y421C probably damaging Het
Strada T C 11: 106,171,158 Y152C probably damaging Het
Top1mt A G 15: 75,669,302 V212A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Tubgcp6 C A 15: 89,102,949 G1274W possibly damaging Het
Unc79 T A 12: 103,104,639 I1231N probably damaging Het
Upp2 T C 2: 58,780,106 S275P probably damaging Het
Usp4 T A 9: 108,388,382 probably null Het
Usp47 A G 7: 112,059,001 T196A probably damaging Het
Vmn2r116 A T 17: 23,385,931 K73* probably null Het
Wdr74 T A 19: 8,737,910 H144Q probably benign Het
Zan A T 5: 137,388,938 M4951K unknown Het
Other mutations in Mid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Mid1 APN X 169927023 missense probably damaging 1.00
LCD18:Mid1 UTSW X 170005564 unclassified probably benign
R1317:Mid1 UTSW X 169986094 missense probably damaging 1.00
R1364:Mid1 UTSW X 169986094 missense probably damaging 1.00
R1366:Mid1 UTSW X 169986094 missense probably damaging 1.00
R4452:Mid1 UTSW X 169927425 missense possibly damaging 0.62
R4678:Mid1 UTSW X 169985048 missense possibly damaging 0.79
R7100:Mid1 UTSW X 169985077 missense probably benign 0.43
R7554:Mid1 UTSW X 169986014 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGCTTTAGTCACACCGCTC -3'
(R):5'- GAAAACAGTCGTCGAACGCG -3'

Sequencing Primer
(F):5'- CTTTAAGTAGACGGCTAAGCGCTC -3'
(R):5'- TCGTCGAACGCGGAAGG -3'
Posted On2020-10-20