Incidental Mutation 'R0368:Slc1a5'
ID 65585
Institutional Source Beutler Lab
Gene Symbol Slc1a5
Ensembl Gene ENSMUSG00000001918
Gene Name solute carrier family 1 (neutral amino acid transporter), member 5
Synonyms ASCT2
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.210) question?
Stock # R0368 (G1)
Quality Score 154
Status Not validated
Chromosome 7
Chromosomal Location 16515265-16532199 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 16516103 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 93 (P93L)
Ref Sequence ENSEMBL: ENSMUSP00000104136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108496]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000108496
AA Change: P93L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104136
Gene: ENSMUSG00000001918
AA Change: P93L

DomainStartEndE-ValueType
Pfam:SDF 55 499 1.5e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135817
SMART Domains Protein: ENSMUSP00000116654
Gene: ENSMUSG00000001918

DomainStartEndE-ValueType
Pfam:SDF 3 139 7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206444
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cells, CD4+ memory T cells in older mice, Th1 and Th17 T cells, susceptibility to EAE and T cell uptake of glutamine and leucine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Slc1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Slc1a5 APN 7 16,520,804 (GRCm39) nonsense probably null
IGL01295:Slc1a5 APN 7 16,529,787 (GRCm39) missense probably damaging 1.00
IGL02388:Slc1a5 APN 7 16,519,644 (GRCm39) critical splice donor site probably null
IGL02863:Slc1a5 APN 7 16,527,646 (GRCm39) missense probably benign
IGL03149:Slc1a5 APN 7 16,523,745 (GRCm39) missense probably damaging 0.96
R0001:Slc1a5 UTSW 7 16,527,562 (GRCm39) splice site probably null
R0690:Slc1a5 UTSW 7 16,520,829 (GRCm39) missense probably benign
R1430:Slc1a5 UTSW 7 16,516,328 (GRCm39) missense probably benign 0.00
R1769:Slc1a5 UTSW 7 16,531,464 (GRCm39) missense probably damaging 1.00
R4058:Slc1a5 UTSW 7 16,529,778 (GRCm39) missense probably damaging 0.98
R4944:Slc1a5 UTSW 7 16,531,668 (GRCm39) utr 3 prime probably benign
R5220:Slc1a5 UTSW 7 16,527,759 (GRCm39) missense probably damaging 1.00
R5976:Slc1a5 UTSW 7 16,529,807 (GRCm39) missense probably damaging 1.00
R5986:Slc1a5 UTSW 7 16,516,151 (GRCm39) missense probably benign 0.26
R7171:Slc1a5 UTSW 7 16,531,463 (GRCm39) missense probably damaging 1.00
R7270:Slc1a5 UTSW 7 16,519,623 (GRCm39) missense probably damaging 1.00
R7345:Slc1a5 UTSW 7 16,530,085 (GRCm39) critical splice donor site probably null
R7630:Slc1a5 UTSW 7 16,529,732 (GRCm39) missense probably damaging 1.00
R7920:Slc1a5 UTSW 7 16,527,795 (GRCm39) missense probably damaging 1.00
R7944:Slc1a5 UTSW 7 16,523,807 (GRCm39) missense possibly damaging 0.50
R7945:Slc1a5 UTSW 7 16,523,807 (GRCm39) missense possibly damaging 0.50
R8221:Slc1a5 UTSW 7 16,515,902 (GRCm39) missense probably benign 0.05
R9709:Slc1a5 UTSW 7 16,527,729 (GRCm39) missense probably benign 0.40
Z1088:Slc1a5 UTSW 7 16,531,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACAAGGAACCTCCCTGTTAC -3'
(R):5'- CAATCTGGAGGACTCAACCTTGGTG -3'

Sequencing Primer
(F):5'- TTACGGCTCAGCATGGCAG -3'
(R):5'- cagagggggtaaagcagaaag -3'
Posted On 2013-08-08