Incidental Mutation 'R8511:Stmn2'
ID 655850
Institutional Source Beutler Lab
Gene Symbol Stmn2
Ensembl Gene ENSMUSG00000027500
Gene Name stathmin-like 2
Synonyms Scgn10, SCG10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 8509360-8561606 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) A to G at 8509555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029002]
AlphaFold P55821
Predicted Effect probably benign
Transcript: ENSMUST00000029002
SMART Domains Protein: ENSMUSP00000029002
Gene: ENSMUSG00000027500

DomainStartEndE-ValueType
Pfam:Stathmin 41 174 3.7e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the stathmin family of phosphoproteins. Stathmin proteins function in microtubule dynamics and signal transduction. The encoded protein plays a regulatory role in neuronal growth and is also thought to be involved in osteogenesis. Reductions in the expression of this gene have been associated with Down's syndrome and Alzheimer's disease. Alternatively spliced transcript variants have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Stmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Stmn2 APN 3 8560261 splice site probably benign
R0362:Stmn2 UTSW 3 8545690 missense probably damaging 0.99
R1885:Stmn2 UTSW 3 8541904 missense probably damaging 1.00
R1927:Stmn2 UTSW 3 8545576 missense probably benign 0.00
R2261:Stmn2 UTSW 3 8541895 missense probably damaging 0.97
R2262:Stmn2 UTSW 3 8541895 missense probably damaging 0.97
R2901:Stmn2 UTSW 3 8541921 missense probably benign
R4066:Stmn2 UTSW 3 8509608 utr 5 prime probably benign
R4938:Stmn2 UTSW 3 8545732 missense probably damaging 1.00
R5191:Stmn2 UTSW 3 8545575 missense probably benign
R7670:Stmn2 UTSW 3 8554865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTACTCCAGCACCATTGGC -3'
(R):5'- CCCGGTTCCTGTCATGAATG -3'

Sequencing Primer
(F):5'- GGCCGATCAATATTTAATGCTTGGAG -3'
(R):5'- GGTTCCTGTCATGAATGTCTTTC -3'
Posted On 2020-10-20