Mutagenetix > Incidental Mutations

Incidental Mutation 'R8511:Arhgef26'

655852

Institutional Source

Beutler Lab

Gene Symbol

Arhgef26

Ensembl Gene

ENSMUSG00000036885

Gene Name

Rho guanine nucleotide exchange factor (GEF) 26

Synonyms

4631416L12Rik, 8430436L14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R8511 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62338344-62462221 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62428929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 630 (M630L)

Ref Sequence

ENSEMBL: ENSMUSP00000078281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079300]

AlphaFold

D3YYY8

Predicted Effect

probably damaging
Transcript: ENSMUST00000079300
AA Change: M630L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: M630L

Domain	Start	End	E-Value	Type
low complexity region	133	144	N/A	INTRINSIC
low complexity region	392	403	N/A	INTRINSIC
RhoGEF	441	620	1e-45	SMART
PH	654	782	4.04e-9	SMART
SH3	790	847	3.82e-13	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124392
Gene: ENSMUSG00000036885
AA Change: M96L

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	2	87	2.3e-19	PFAM
PH	121	249	4.04e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	T	C	11: 11,590,056	H186R	unknown	Het
4931409K22Rik	T	A	5: 24,545,908	H559L	possibly damaging	Het
6430548M08Rik	A	G	8: 120,152,562	N233S	probably benign	Het
Acan	A	G	7: 79,097,935	D818G	possibly damaging	Het
Adam22	G	A	5: 8,134,558	T478I	probably damaging	Het
Agmo	T	A	12: 37,244,397	*115R	probably null	Het
Ahnak	A	G	19: 9,012,355	K3668E	unknown	Het
Aldh6a1	G	A	12: 84,433,971	T430I	possibly damaging	Het
Ankrd11	T	C	8: 122,899,729	D17G		Het
Apol10b	C	G	15: 77,585,010	E322D	probably benign	Het
Apol10b	T	C	15: 77,585,011	E322G	probably benign	Het
Apol8	C	T	15: 77,750,073	G101E	probably benign	Het
Aspm	T	C	1: 139,457,308	L230P	probably damaging	Het
Atg101	T	C	15: 101,290,622	S203P	probably damaging	Het
Baz2b	T	A	2: 59,901,814	T1996S	probably benign	Het
Brwd1	A	T	16: 96,058,738	M350K	probably damaging	Het
Cad	A	G	5: 31,075,821	K1869R	probably benign	Het
Caskin1	A	T	17: 24,505,936	I1233F	probably benign	Het
Ckap5	T	A	2: 91,615,147	L1770I	possibly damaging	Het
Clip1	T	C	5: 123,653,906	N67S	possibly damaging	Het
Csmd2	A	G	4: 128,368,899	N626S		Het
Cuedc2	C	A	19: 46,330,919		probably null	Het
Dmbt1	A	T	7: 131,102,012	N1275Y	unknown	Het
Dnm3	A	G	1: 162,286,042	V483A	possibly damaging	Het
Dock9	T	C	14: 121,681,435	D50G	probably damaging	Het
Dock9	A	T	14: 121,627,389	H718Q	probably benign	Het
Egfr	T	G	11: 16,896,949	I782S	probably damaging	Het
Elmod1	A	T	9: 53,912,811	F298I	probably damaging	Het
Enthd1	T	C	15: 80,474,227	Q364R	probably damaging	Het
Fat2	T	A	11: 55,309,237	S1004C	probably damaging	Het
Fga	A	T	3: 83,031,757	K480*	probably null	Het
Fhod3	A	G	18: 25,132,937	T1561A	probably damaging	Het
Foxg1	T	A	12: 49,385,085	Y200*	probably null	Het
Foxj2	C	T	6: 122,831,445	R115*	probably null	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm15922	A	G	7: 3,739,348	L60P	probably damaging	Het
Gpsm2	A	G	3: 108,682,083	S580P	probably benign	Het
Hectd1	A	G	12: 51,787,871	S870P	probably benign	Het
Hic2	T	A	16: 17,258,010	N234K	possibly damaging	Het
Ica1	A	G	6: 8,754,726	F15L	probably benign	Het
Immp1l	G	A	2: 105,930,755	R3H	probably benign	Het
Jak3	T	A	8: 71,685,550	Y882N	probably damaging	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Luzp1	A	G	4: 136,541,339	D291G	probably damaging	Het
Map3k19	C	T	1: 127,847,418	E61K	possibly damaging	Het
Mical3	A	G	6: 121,038,552	I175T	possibly damaging	Het
Nectin3	G	A	16: 46,464,000	P107L	probably damaging	Het
Olfr975	A	G	9: 39,950,159	V204A	probably benign	Het
Polr1a	C	A	6: 71,920,520	H207N	probably benign	Het
Prokr2	A	G	2: 132,381,502	V40A	probably benign	Het
Prtg	T	C	9: 72,890,874		probably null	Het
Ptprs	G	A	17: 56,447,440	T200I	probably damaging	Het
Ramp3	C	T	11: 6,676,709	R139C	probably benign	Het
Scfd2	A	G	5: 74,212,288	V642A	possibly damaging	Het
Scn11a	T	C	9: 119,789,915	K787R	probably damaging	Het
Slco3a1	A	G	7: 74,303,242	V523A	probably benign	Het
Smo	A	G	6: 29,755,532	Y401C	probably damaging	Het
Spata5	A	G	3: 37,436,748	M481V	probably damaging	Het
Stmn2	A	G	3: 8,509,555		probably benign	Het
Stra6l	G	T	4: 45,885,347	G605V	probably benign	Het
Syne2	A	G	12: 76,008,873	I4170V	probably benign	Het
Tgm7	T	A	2: 121,093,660	I594F	probably damaging	Het
Tle2	T	C	10: 81,587,996	L648P	probably damaging	Het
Tmprss2	G	T	16: 97,568,462	L371I	possibly damaging	Het
Ttn	T	C	2: 76,749,522	R23676G	probably damaging	Het
Tvp23b	T	C	11: 62,883,737	I69T	possibly damaging	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	A	T	17: 19,394,181	D721V	probably damaging	Het
Zan	A	T	5: 137,446,846	V1717E	unknown	Het
Zmiz2	C	T	11: 6,403,190	H658Y	probably damaging	Het

Other mutations in Arhgef26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Arhgef26	APN	3	62340383	missense	probably benign
IGL01060:Arhgef26	APN	3	62340121	missense	probably benign	0.44
IGL01942:Arhgef26	APN	3	62340094	missense	probably benign	0.03
IGL02085:Arhgef26	APN	3	62459724	intron	probably benign
IGL02172:Arhgef26	APN	3	62459676	missense	probably benign	0.03
IGL03017:Arhgef26	APN	3	62448281	missense	possibly damaging	0.46
IGL03101:Arhgef26	APN	3	62419661	missense	possibly damaging	0.95
IGL03296:Arhgef26	APN	3	62423505	missense	probably damaging	1.00
IGL03401:Arhgef26	APN	3	62423532	missense	possibly damaging	0.95
R0138:Arhgef26	UTSW	3	62448259	missense	probably benign	0.06
R0140:Arhgef26	UTSW	3	62448245	missense	probably benign	0.02
R0152:Arhgef26	UTSW	3	62423544	missense	probably damaging	0.99
R0157:Arhgef26	UTSW	3	62380971	missense	probably damaging	1.00
R0308:Arhgef26	UTSW	3	62340399	missense	probably benign	0.01
R0317:Arhgef26	UTSW	3	62423544	missense	probably damaging	0.99
R0529:Arhgef26	UTSW	3	62339725	missense	probably benign
R0825:Arhgef26	UTSW	3	62426593	missense	probably damaging	0.97
R1331:Arhgef26	UTSW	3	62340028	missense	probably benign	0.00
R1333:Arhgef26	UTSW	3	62340323	missense	probably benign	0.04
R1351:Arhgef26	UTSW	3	62380841	missense	probably damaging	1.00
R1740:Arhgef26	UTSW	3	62423583	missense	probably damaging	1.00
R2121:Arhgef26	UTSW	3	62340283	missense	probably damaging	0.96
R2404:Arhgef26	UTSW	3	62428915	missense	possibly damaging	0.90
R2437:Arhgef26	UTSW	3	62432581	missense	probably damaging	0.96
R2939:Arhgef26	UTSW	3	62380910	missense	possibly damaging	0.72
R3084:Arhgef26	UTSW	3	62377616	missense	probably benign	0.19
R3712:Arhgef26	UTSW	3	62423629	missense	probably damaging	1.00
R4005:Arhgef26	UTSW	3	62340395	missense	probably benign
R4225:Arhgef26	UTSW	3	62380922	missense	probably benign	0.00
R4635:Arhgef26	UTSW	3	62340440	missense	probably damaging	1.00
R4961:Arhgef26	UTSW	3	62459625	missense	probably damaging	1.00
R4989:Arhgef26	UTSW	3	62340385	missense	possibly damaging	0.94
R5249:Arhgef26	UTSW	3	62340560	missense	probably damaging	1.00
R5284:Arhgef26	UTSW	3	62419631	missense	probably damaging	0.99
R5661:Arhgef26	UTSW	3	62377654	splice site	probably benign
R5970:Arhgef26	UTSW	3	62340047	missense	probably benign
R6022:Arhgef26	UTSW	3	62428939	missense	probably damaging	1.00
R6193:Arhgef26	UTSW	3	62339792	missense	possibly damaging	0.49
R6247:Arhgef26	UTSW	3	62380960	missense	probably damaging	1.00
R6434:Arhgef26	UTSW	3	62428914	missense	probably damaging	0.99
R6827:Arhgef26	UTSW	3	62423498	splice site	probably null
R7111:Arhgef26	UTSW	3	62345268	missense	possibly damaging	0.90
R7128:Arhgef26	UTSW	3	62419550	missense	possibly damaging	0.94
R7360:Arhgef26	UTSW	3	62448205	missense	possibly damaging	0.63
R7456:Arhgef26	UTSW	3	62340055	missense	probably benign	0.00
R8039:Arhgef26	UTSW	3	62339930	missense	probably benign	0.32
R8120:Arhgef26	UTSW	3	62341375	missense	probably damaging	1.00
R8887:Arhgef26	UTSW	3	62339980	missense	probably benign	0.04
R8979:Arhgef26	UTSW	3	62339548	missense	possibly damaging	0.78
R8993:Arhgef26	UTSW	3	62448104	missense	probably benign	0.43
R9213:Arhgef26	UTSW	3	62432579	missense	probably benign	0.03
R9269:Arhgef26	UTSW	3	62340499	missense	probably damaging	0.98
Z1177:Arhgef26	UTSW	3	62339930	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- ACGGGTCCCTGGAATTTCTG -3'
(R):5'- TGGAGACACCCTTAGGCATCTG -3'

Sequencing Primer
(F):5'- CCCTGGAATTTCTGGAAAGTAGATC -3'
(R):5'- ACCCTTAGGCATCTGGGGAG -3'

Posted On

2020-10-20