Incidental Mutation 'R8511:Stra6l'
ID 655855
Institutional Source Beutler Lab
Gene Symbol Stra6l
Ensembl Gene ENSMUSG00000028327
Gene Name STRA6-like
Synonyms Rbpr2, 1300002K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 45848664-45887008 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45885347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 605 (G605V)
Ref Sequence ENSEMBL: ENSMUSP00000030011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030011] [ENSMUST00000107782] [ENSMUST00000107783] [ENSMUST00000178561]
AlphaFold Q9DBN1
Predicted Effect probably benign
Transcript: ENSMUST00000030011
AA Change: G605V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030011
Gene: ENSMUSG00000028327
AA Change: G605V

DomainStartEndE-ValueType
Pfam:RBP_receptor 13 602 8.7e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107782
AA Change: G514V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103411
Gene: ENSMUSG00000028327
AA Change: G514V

DomainStartEndE-ValueType
Pfam:RBP_receptor 1 512 2.8e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107783
AA Change: G605V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103412
Gene: ENSMUSG00000028327
AA Change: G605V

DomainStartEndE-ValueType
Pfam:RBP_receptor 12 603 1e-254 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178561
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Stra6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Stra6l APN 4 45864864 splice site probably null
IGL02343:Stra6l APN 4 45869588 missense probably damaging 0.99
IGL02710:Stra6l APN 4 45882728 missense possibly damaging 0.72
IGL02880:Stra6l APN 4 45885278 missense possibly damaging 0.70
IGL03034:Stra6l APN 4 45885392 missense probably benign 0.41
IGL03163:Stra6l APN 4 45881455 missense probably benign 0.03
IGL03355:Stra6l APN 4 45873689 missense probably benign 0.16
K2124:Stra6l UTSW 4 45870770 splice site probably benign
R0800:Stra6l UTSW 4 45882797 missense probably benign 0.29
R1171:Stra6l UTSW 4 45864982 missense probably benign
R1931:Stra6l UTSW 4 45882698 nonsense probably null
R1982:Stra6l UTSW 4 45867237 nonsense probably null
R2331:Stra6l UTSW 4 45858224 critical splice donor site probably null
R4691:Stra6l UTSW 4 45882851 missense probably benign 0.39
R4846:Stra6l UTSW 4 45873682 missense possibly damaging 0.76
R5175:Stra6l UTSW 4 45870860 missense probably benign 0.01
R5633:Stra6l UTSW 4 45881455 missense probably benign 0.00
R6212:Stra6l UTSW 4 45884664 missense probably benign
R6517:Stra6l UTSW 4 45879473 missense probably benign
R6534:Stra6l UTSW 4 45860041 splice site probably null
R6584:Stra6l UTSW 4 45869635 splice site probably null
R7763:Stra6l UTSW 4 45869570 nonsense probably null
R8400:Stra6l UTSW 4 45864905 missense probably damaging 1.00
R9007:Stra6l UTSW 4 45864910 missense possibly damaging 0.81
R9313:Stra6l UTSW 4 45881454 missense probably benign
R9379:Stra6l UTSW 4 45849093 missense probably benign
R9400:Stra6l UTSW 4 45885293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTCCAAAAGTCTTTCAG -3'
(R):5'- TGTGCCAAGGGACTGAGATC -3'

Sequencing Primer
(F):5'- GTCTTTCAGAATAGCAGCGGTAACAC -3'
(R):5'- ACAAGTGGTCAGTGCCGTCTATC -3'
Posted On 2020-10-20