Mutagenetix > Incidental Mutations

Incidental Mutation 'R8511:Clip1'

655862

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8511 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123653906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 67 (N67S)

Ref Sequence

ENSEMBL: ENSMUSP00000107190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]

AlphaFold

Q922J3

PDB Structure

Solution structure of the 1st CAP-Gly domain in mouse CLIP-170/restin [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000031382
AA Change: N67S

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: N67S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000063905
AA Change: N67S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: N67S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111561
AA Change: N67S

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: N67S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111564
AA Change: N67S

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: N67S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111566
AA Change: N67S

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: N67S

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550
AA Change: N43S

Domain	Start	End	E-Value	Type
CAP_GLY	37	102	1.05e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149410
AA Change: N67S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550
AA Change: N67S

Domain	Start	End	E-Value	Type
low complexity region	26	32	N/A	INTRINSIC
CAP_GLY	60	125	1.05e-31	SMART
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	334	458	N/A	INTRINSIC
coiled coil region	504	543	N/A	INTRINSIC
coiled coil region	575	827	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	T	C	11: 11,590,056	H186R	unknown	Het
4931409K22Rik	T	A	5: 24,545,908	H559L	possibly damaging	Het
6430548M08Rik	A	G	8: 120,152,562	N233S	probably benign	Het
Acan	A	G	7: 79,097,935	D818G	possibly damaging	Het
Adam22	G	A	5: 8,134,558	T478I	probably damaging	Het
Agmo	T	A	12: 37,244,397	*115R	probably null	Het
Ahnak	A	G	19: 9,012,355	K3668E	unknown	Het
Aldh6a1	G	A	12: 84,433,971	T430I	possibly damaging	Het
Ankrd11	T	C	8: 122,899,729	D17G		Het
Apol10b	C	G	15: 77,585,010	E322D	probably benign	Het
Apol10b	T	C	15: 77,585,011	E322G	probably benign	Het
Apol8	C	T	15: 77,750,073	G101E	probably benign	Het
Arhgef26	A	T	3: 62,428,929	M630L	probably damaging	Het
Aspm	T	C	1: 139,457,308	L230P	probably damaging	Het
Atg101	T	C	15: 101,290,622	S203P	probably damaging	Het
Baz2b	T	A	2: 59,901,814	T1996S	probably benign	Het
Brwd1	A	T	16: 96,058,738	M350K	probably damaging	Het
Cad	A	G	5: 31,075,821	K1869R	probably benign	Het
Caskin1	A	T	17: 24,505,936	I1233F	probably benign	Het
Ckap5	T	A	2: 91,615,147	L1770I	possibly damaging	Het
Csmd2	A	G	4: 128,368,899	N626S		Het
Cuedc2	C	A	19: 46,330,919		probably null	Het
Dmbt1	A	T	7: 131,102,012	N1275Y	unknown	Het
Dnm3	A	G	1: 162,286,042	V483A	possibly damaging	Het
Dock9	A	T	14: 121,627,389	H718Q	probably benign	Het
Dock9	T	C	14: 121,681,435	D50G	probably damaging	Het
Egfr	T	G	11: 16,896,949	I782S	probably damaging	Het
Elmod1	A	T	9: 53,912,811	F298I	probably damaging	Het
Enthd1	T	C	15: 80,474,227	Q364R	probably damaging	Het
Fat2	T	A	11: 55,309,237	S1004C	probably damaging	Het
Fga	A	T	3: 83,031,757	K480*	probably null	Het
Fhod3	A	G	18: 25,132,937	T1561A	probably damaging	Het
Foxg1	T	A	12: 49,385,085	Y200*	probably null	Het
Foxj2	C	T	6: 122,831,445	R115*	probably null	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm15922	A	G	7: 3,739,348	L60P	probably damaging	Het
Gpsm2	A	G	3: 108,682,083	S580P	probably benign	Het
Hectd1	A	G	12: 51,787,871	S870P	probably benign	Het
Hic2	T	A	16: 17,258,010	N234K	possibly damaging	Het
Ica1	A	G	6: 8,754,726	F15L	probably benign	Het
Immp1l	G	A	2: 105,930,755	R3H	probably benign	Het
Jak3	T	A	8: 71,685,550	Y882N	probably damaging	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Luzp1	A	G	4: 136,541,339	D291G	probably damaging	Het
Map3k19	C	T	1: 127,847,418	E61K	possibly damaging	Het
Mical3	A	G	6: 121,038,552	I175T	possibly damaging	Het
Nectin3	G	A	16: 46,464,000	P107L	probably damaging	Het
Olfr975	A	G	9: 39,950,159	V204A	probably benign	Het
Polr1a	C	A	6: 71,920,520	H207N	probably benign	Het
Prokr2	A	G	2: 132,381,502	V40A	probably benign	Het
Prtg	T	C	9: 72,890,874		probably null	Het
Ptprs	G	A	17: 56,447,440	T200I	probably damaging	Het
Ramp3	C	T	11: 6,676,709	R139C	probably benign	Het
Scfd2	A	G	5: 74,212,288	V642A	possibly damaging	Het
Scn11a	T	C	9: 119,789,915	K787R	probably damaging	Het
Slco3a1	A	G	7: 74,303,242	V523A	probably benign	Het
Smo	A	G	6: 29,755,532	Y401C	probably damaging	Het
Spata5	A	G	3: 37,436,748	M481V	probably damaging	Het
Stmn2	A	G	3: 8,509,555		probably benign	Het
Stra6l	G	T	4: 45,885,347	G605V	probably benign	Het
Syne2	A	G	12: 76,008,873	I4170V	probably benign	Het
Tgm7	T	A	2: 121,093,660	I594F	probably damaging	Het
Tle2	T	C	10: 81,587,996	L648P	probably damaging	Het
Tmprss2	G	T	16: 97,568,462	L371I	possibly damaging	Het
Ttn	T	C	2: 76,749,522	R23676G	probably damaging	Het
Tvp23b	T	C	11: 62,883,737	I69T	possibly damaging	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	A	T	17: 19,394,181	D721V	probably damaging	Het
Zan	A	T	5: 137,446,846	V1717E	unknown	Het
Zmiz2	C	T	11: 6,403,190	H658Y	probably damaging	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123579491	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123630681	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6183:Clip1	UTSW	5	123642604	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7015:Clip1	UTSW	5	123613612	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123613794	missense
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123583385	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8731:Clip1	UTSW	5	123614693	missense
R8889:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R8892:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123614582	missense
R9106:Clip1	UTSW	5	123615160	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123583336	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123579378	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123646274	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123613123	missense
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAGGTGAAGCAGTTCTCCC -3'
(R):5'- GTTAGAGGACAGCTGCTCAG -3'

Sequencing Primer
(F):5'- TGAAGCAGTTCTCCCAGGAG -3'
(R):5'- CTCAGCTATGATGTGGGACC -3'

Posted On

2020-10-20