Mutagenetix > Incidental Mutations

Incidental Mutation 'R8511:Polr1a'

655866

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8511 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71920520 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 207 (H207N)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

Predicted Effect

probably benign
Transcript: ENSMUST00000055296
AA Change: H207N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: H207N

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206556
AA Change: H207N

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	T	C	11: 11,590,056	H186R	unknown	Het
4931409K22Rik	T	A	5: 24,545,908	H559L	possibly damaging	Het
6430548M08Rik	A	G	8: 120,152,562	N233S	probably benign	Het
Acan	A	G	7: 79,097,935	D818G	possibly damaging	Het
Adam22	G	A	5: 8,134,558	T478I	probably damaging	Het
Agmo	T	A	12: 37,244,397	*115R	probably null	Het
Ahnak	A	G	19: 9,012,355	K3668E	unknown	Het
Aldh6a1	G	A	12: 84,433,971	T430I	possibly damaging	Het
Ankrd11	T	C	8: 122,899,729	D17G		Het
Apol10b	C	G	15: 77,585,010	E322D	probably benign	Het
Apol10b	T	C	15: 77,585,011	E322G	probably benign	Het
Apol8	C	T	15: 77,750,073	G101E	probably benign	Het
Arhgef26	A	T	3: 62,428,929	M630L	probably damaging	Het
Aspm	T	C	1: 139,457,308	L230P	probably damaging	Het
Atg101	T	C	15: 101,290,622	S203P	probably damaging	Het
Baz2b	T	A	2: 59,901,814	T1996S	probably benign	Het
Brwd1	A	T	16: 96,058,738	M350K	probably damaging	Het
Cad	A	G	5: 31,075,821	K1869R	probably benign	Het
Caskin1	A	T	17: 24,505,936	I1233F	probably benign	Het
Ckap5	T	A	2: 91,615,147	L1770I	possibly damaging	Het
Clip1	T	C	5: 123,653,906	N67S	possibly damaging	Het
Csmd2	A	G	4: 128,368,899	N626S		Het
Cuedc2	C	A	19: 46,330,919		probably null	Het
Dmbt1	A	T	7: 131,102,012	N1275Y	unknown	Het
Dnm3	A	G	1: 162,286,042	V483A	possibly damaging	Het
Dock9	A	T	14: 121,627,389	H718Q	probably benign	Het
Dock9	T	C	14: 121,681,435	D50G	probably damaging	Het
Egfr	T	G	11: 16,896,949	I782S	probably damaging	Het
Elmod1	A	T	9: 53,912,811	F298I	probably damaging	Het
Enthd1	T	C	15: 80,474,227	Q364R	probably damaging	Het
Fat2	T	A	11: 55,309,237	S1004C	probably damaging	Het
Fga	A	T	3: 83,031,757	K480*	probably null	Het
Fhod3	A	G	18: 25,132,937	T1561A	probably damaging	Het
Foxg1	T	A	12: 49,385,085	Y200*	probably null	Het
Foxj2	C	T	6: 122,831,445	R115*	probably null	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm15922	A	G	7: 3,739,348	L60P	probably damaging	Het
Gpsm2	A	G	3: 108,682,083	S580P	probably benign	Het
Hectd1	A	G	12: 51,787,871	S870P	probably benign	Het
Hic2	T	A	16: 17,258,010	N234K	possibly damaging	Het
Ica1	A	G	6: 8,754,726	F15L	probably benign	Het
Immp1l	G	A	2: 105,930,755	R3H	probably benign	Het
Jak3	T	A	8: 71,685,550	Y882N	probably damaging	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Luzp1	A	G	4: 136,541,339	D291G	probably damaging	Het
Map3k19	C	T	1: 127,847,418	E61K	possibly damaging	Het
Mical3	A	G	6: 121,038,552	I175T	possibly damaging	Het
Nectin3	G	A	16: 46,464,000	P107L	probably damaging	Het
Olfr975	A	G	9: 39,950,159	V204A	probably benign	Het
Prokr2	A	G	2: 132,381,502	V40A	probably benign	Het
Prtg	T	C	9: 72,890,874		probably null	Het
Ptprs	G	A	17: 56,447,440	T200I	probably damaging	Het
Ramp3	C	T	11: 6,676,709	R139C	probably benign	Het
Scfd2	A	G	5: 74,212,288	V642A	possibly damaging	Het
Scn11a	T	C	9: 119,789,915	K787R	probably damaging	Het
Slco3a1	A	G	7: 74,303,242	V523A	probably benign	Het
Smo	A	G	6: 29,755,532	Y401C	probably damaging	Het
Spata5	A	G	3: 37,436,748	M481V	probably damaging	Het
Stmn2	A	G	3: 8,509,555		probably benign	Het
Stra6l	G	T	4: 45,885,347	G605V	probably benign	Het
Syne2	A	G	12: 76,008,873	I4170V	probably benign	Het
Tgm7	T	A	2: 121,093,660	I594F	probably damaging	Het
Tle2	T	C	10: 81,587,996	L648P	probably damaging	Het
Tmprss2	G	T	16: 97,568,462	L371I	possibly damaging	Het
Ttn	T	C	2: 76,749,522	R23676G	probably damaging	Het
Tvp23b	T	C	11: 62,883,737	I69T	possibly damaging	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	A	T	17: 19,394,181	D721V	probably damaging	Het
Zan	A	T	5: 137,446,846	V1717E	unknown	Het
Zmiz2	C	T	11: 6,403,190	H658Y	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTCTCTTCAGAGCAGCACTC -3'
(R):5'- ATTTCTTGTGCACCGTGGC -3'

Sequencing Primer
(F):5'- ATAATCCCGTTTCGTGAGAGGC -3'
(R):5'- CACCGTGGCTGGGTATG -3'

Posted On

2020-10-20