Incidental Mutation 'R8511:Acan'
ID655872
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8511 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79097935 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 818 (D818G)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032835
AA Change: D818G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: D818G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8482:Acan UTSW 7 79096744 missense probably benign 0.02
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8753:Acan UTSW 7 79098768 missense possibly damaging 0.83
R8810:Acan UTSW 7 79099704 missense probably damaging 1.00
R8898:Acan UTSW 7 79100353 missense possibly damaging 0.59
R8956:Acan UTSW 7 79100965 missense probably benign 0.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTTCACCATTCCACACTTC -3'
(R):5'- CTCCTGAGGCAGAACCACTTTC -3'

Sequencing Primer
(F):5'- GGATCCCTCCCACATGGC -3'
(R):5'- TGAGGCAGAACCACTTTCTACAGG -3'
Posted On2020-10-20