Mutagenetix > Incidental Mutations

Incidental Mutation 'R8511:Ankrd11'

655877

Institutional Source

Beutler Lab

Gene Symbol

Ankrd11

Ensembl Gene

ENSMUSG00000035569

Gene Name

ankyrin repeat domain 11

Synonyms

3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8511 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122883822-123042277 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122899729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 17 (D17G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]

AlphaFold

E9Q4F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000098333
AA Change: D180G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: D180G

Domain	Start	End	E-Value	Type
ANK	188	217	2.58e-3	SMART
ANK	221	250	1.31e-4	SMART
ANK	254	283	5.04e-6	SMART
low complexity region	311	324	N/A	INTRINSIC
low complexity region	366	377	N/A	INTRINSIC
low complexity region	429	440	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	499	521	N/A	INTRINSIC
low complexity region	534	549	N/A	INTRINSIC
low complexity region	596	609	N/A	INTRINSIC
low complexity region	649	669	N/A	INTRINSIC
coiled coil region	786	826	N/A	INTRINSIC
low complexity region	867	877	N/A	INTRINSIC
low complexity region	965	984	N/A	INTRINSIC
low complexity region	1040	1055	N/A	INTRINSIC
low complexity region	1058	1082	N/A	INTRINSIC
low complexity region	1187	1200	N/A	INTRINSIC
low complexity region	1204	1227	N/A	INTRINSIC
low complexity region	1268	1289	N/A	INTRINSIC
low complexity region	1294	1306	N/A	INTRINSIC
coiled coil region	1374	1406	N/A	INTRINSIC
low complexity region	1476	1496	N/A	INTRINSIC
low complexity region	1508	1523	N/A	INTRINSIC
low complexity region	1526	1547	N/A	INTRINSIC
coiled coil region	1598	1625	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1874	1885	N/A	INTRINSIC
low complexity region	1913	1922	N/A	INTRINSIC
low complexity region	1969	1979	N/A	INTRINSIC
low complexity region	2035	2045	N/A	INTRINSIC
low complexity region	2057	2071	N/A	INTRINSIC
low complexity region	2162	2179	N/A	INTRINSIC
low complexity region	2191	2209	N/A	INTRINSIC
low complexity region	2224	2236	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC
low complexity region	2294	2305	N/A	INTRINSIC
low complexity region	2391	2409	N/A	INTRINSIC
low complexity region	2445	2455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098334
AA Change: D159G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: D159G

Domain	Start	End	E-Value	Type
ANK	167	196	2.58e-3	SMART
ANK	200	229	1.31e-4	SMART
ANK	233	262	5.04e-6	SMART
low complexity region	290	303	N/A	INTRINSIC
low complexity region	345	356	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
low complexity region	449	466	N/A	INTRINSIC
low complexity region	478	500	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	575	588	N/A	INTRINSIC
low complexity region	628	648	N/A	INTRINSIC
coiled coil region	765	805	N/A	INTRINSIC
low complexity region	846	856	N/A	INTRINSIC
low complexity region	944	963	N/A	INTRINSIC
low complexity region	1019	1034	N/A	INTRINSIC
low complexity region	1037	1061	N/A	INTRINSIC
low complexity region	1166	1179	N/A	INTRINSIC
low complexity region	1183	1206	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1273	1285	N/A	INTRINSIC
coiled coil region	1353	1385	N/A	INTRINSIC
low complexity region	1455	1475	N/A	INTRINSIC
low complexity region	1487	1502	N/A	INTRINSIC
low complexity region	1505	1526	N/A	INTRINSIC
coiled coil region	1577	1604	N/A	INTRINSIC
low complexity region	1749	1760	N/A	INTRINSIC
low complexity region	1853	1864	N/A	INTRINSIC
low complexity region	1892	1901	N/A	INTRINSIC
low complexity region	1948	1958	N/A	INTRINSIC
low complexity region	2014	2024	N/A	INTRINSIC
low complexity region	2036	2050	N/A	INTRINSIC
low complexity region	2141	2158	N/A	INTRINSIC
low complexity region	2170	2188	N/A	INTRINSIC
low complexity region	2203	2215	N/A	INTRINSIC
low complexity region	2229	2242	N/A	INTRINSIC
low complexity region	2273	2284	N/A	INTRINSIC
low complexity region	2370	2388	N/A	INTRINSIC
low complexity region	2424	2434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172906

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	T	C	11: 11,590,056	H186R	unknown	Het
4931409K22Rik	T	A	5: 24,545,908	H559L	possibly damaging	Het
6430548M08Rik	A	G	8: 120,152,562	N233S	probably benign	Het
Acan	A	G	7: 79,097,935	D818G	possibly damaging	Het
Adam22	G	A	5: 8,134,558	T478I	probably damaging	Het
Agmo	T	A	12: 37,244,397	*115R	probably null	Het
Ahnak	A	G	19: 9,012,355	K3668E	unknown	Het
Aldh6a1	G	A	12: 84,433,971	T430I	possibly damaging	Het
Apol10b	C	G	15: 77,585,010	E322D	probably benign	Het
Apol10b	T	C	15: 77,585,011	E322G	probably benign	Het
Apol8	C	T	15: 77,750,073	G101E	probably benign	Het
Arhgef26	A	T	3: 62,428,929	M630L	probably damaging	Het
Aspm	T	C	1: 139,457,308	L230P	probably damaging	Het
Atg101	T	C	15: 101,290,622	S203P	probably damaging	Het
Baz2b	T	A	2: 59,901,814	T1996S	probably benign	Het
Brwd1	A	T	16: 96,058,738	M350K	probably damaging	Het
Cad	A	G	5: 31,075,821	K1869R	probably benign	Het
Caskin1	A	T	17: 24,505,936	I1233F	probably benign	Het
Ckap5	T	A	2: 91,615,147	L1770I	possibly damaging	Het
Clip1	T	C	5: 123,653,906	N67S	possibly damaging	Het
Csmd2	A	G	4: 128,368,899	N626S		Het
Cuedc2	C	A	19: 46,330,919		probably null	Het
Dmbt1	A	T	7: 131,102,012	N1275Y	unknown	Het
Dnm3	A	G	1: 162,286,042	V483A	possibly damaging	Het
Dock9	A	T	14: 121,627,389	H718Q	probably benign	Het
Dock9	T	C	14: 121,681,435	D50G	probably damaging	Het
Egfr	T	G	11: 16,896,949	I782S	probably damaging	Het
Elmod1	A	T	9: 53,912,811	F298I	probably damaging	Het
Enthd1	T	C	15: 80,474,227	Q364R	probably damaging	Het
Fat2	T	A	11: 55,309,237	S1004C	probably damaging	Het
Fga	A	T	3: 83,031,757	K480*	probably null	Het
Fhod3	A	G	18: 25,132,937	T1561A	probably damaging	Het
Foxg1	T	A	12: 49,385,085	Y200*	probably null	Het
Foxj2	C	T	6: 122,831,445	R115*	probably null	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm15922	A	G	7: 3,739,348	L60P	probably damaging	Het
Gpsm2	A	G	3: 108,682,083	S580P	probably benign	Het
Hectd1	A	G	12: 51,787,871	S870P	probably benign	Het
Hic2	T	A	16: 17,258,010	N234K	possibly damaging	Het
Ica1	A	G	6: 8,754,726	F15L	probably benign	Het
Immp1l	G	A	2: 105,930,755	R3H	probably benign	Het
Jak3	T	A	8: 71,685,550	Y882N	probably damaging	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Luzp1	A	G	4: 136,541,339	D291G	probably damaging	Het
Map3k19	C	T	1: 127,847,418	E61K	possibly damaging	Het
Mical3	A	G	6: 121,038,552	I175T	possibly damaging	Het
Nectin3	G	A	16: 46,464,000	P107L	probably damaging	Het
Olfr975	A	G	9: 39,950,159	V204A	probably benign	Het
Polr1a	C	A	6: 71,920,520	H207N	probably benign	Het
Prokr2	A	G	2: 132,381,502	V40A	probably benign	Het
Prtg	T	C	9: 72,890,874		probably null	Het
Ptprs	G	A	17: 56,447,440	T200I	probably damaging	Het
Ramp3	C	T	11: 6,676,709	R139C	probably benign	Het
Scfd2	A	G	5: 74,212,288	V642A	possibly damaging	Het
Scn11a	T	C	9: 119,789,915	K787R	probably damaging	Het
Slco3a1	A	G	7: 74,303,242	V523A	probably benign	Het
Smo	A	G	6: 29,755,532	Y401C	probably damaging	Het
Spata5	A	G	3: 37,436,748	M481V	probably damaging	Het
Stmn2	A	G	3: 8,509,555		probably benign	Het
Stra6l	G	T	4: 45,885,347	G605V	probably benign	Het
Syne2	A	G	12: 76,008,873	I4170V	probably benign	Het
Tgm7	T	A	2: 121,093,660	I594F	probably damaging	Het
Tle2	T	C	10: 81,587,996	L648P	probably damaging	Het
Tmprss2	G	T	16: 97,568,462	L371I	possibly damaging	Het
Ttn	T	C	2: 76,749,522	R23676G	probably damaging	Het
Tvp23b	T	C	11: 62,883,737	I69T	possibly damaging	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	A	T	17: 19,394,181	D721V	probably damaging	Het
Zan	A	T	5: 137,446,846	V1717E	unknown	Het
Zmiz2	C	T	11: 6,403,190	H658Y	probably damaging	Het

Other mutations in Ankrd11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ankrd11	APN	8	122908728	missense	possibly damaging	0.59
IGL00971:Ankrd11	APN	8	122895353	missense	probably damaging	1.00
IGL01017:Ankrd11	APN	8	122894728	missense	probably damaging	1.00
IGL01137:Ankrd11	APN	8	122884336	missense	probably damaging	0.99
IGL01659:Ankrd11	APN	8	122895371	missense	probably damaging	1.00
IGL01920:Ankrd11	APN	8	122915897	splice site	probably benign
IGL01964:Ankrd11	APN	8	122889736	missense	probably damaging	0.97
IGL02131:Ankrd11	APN	8	122894410	missense	probably damaging	1.00
IGL02226:Ankrd11	APN	8	122892245	missense	probably damaging	1.00
IGL02549:Ankrd11	APN	8	122891293	missense	probably damaging	1.00
IGL02642:Ankrd11	APN	8	122890651	missense	probably damaging	1.00
IGL02643:Ankrd11	APN	8	122892322	missense	probably damaging	0.98
IGL02861:Ankrd11	APN	8	122895827	missense	probably damaging	0.99
IGL03086:Ankrd11	APN	8	122894510	missense	probably damaging	1.00
IGL03336:Ankrd11	APN	8	122891843	missense	probably benign	0.00
anchors	UTSW	8	122895770	missense	probably damaging	0.99
away	UTSW	8	122891953	missense	probably damaging	1.00
bluebell	UTSW	8	122891785	missense	probably damaging	0.97
Navy	UTSW	8	122908734	nonsense	probably null
BB001:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
BB011:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0110:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0281:Ankrd11	UTSW	8	122895568	missense	probably benign	0.01
R0450:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0481:Ankrd11	UTSW	8	122900036	missense	probably damaging	1.00
R0542:Ankrd11	UTSW	8	122895770	missense	probably damaging	0.99
R0606:Ankrd11	UTSW	8	122892832	missense	probably benign	0.04
R0702:Ankrd11	UTSW	8	122889766	missense	probably damaging	1.00
R0730:Ankrd11	UTSW	8	122891953	missense	probably damaging	1.00
R0737:Ankrd11	UTSW	8	122895836	missense	probably damaging	0.99
R1401:Ankrd11	UTSW	8	122893050	missense	probably benign	0.23
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1641:Ankrd11	UTSW	8	122891746	missense	probably benign	0.03
R1950:Ankrd11	UTSW	8	122889869	missense	probably damaging	1.00
R2004:Ankrd11	UTSW	8	122902422	critical splice donor site	probably null
R2401:Ankrd11	UTSW	8	122908734	nonsense	probably null
R2425:Ankrd11	UTSW	8	122893163	missense	possibly damaging	0.86
R2830:Ankrd11	UTSW	8	122892196	missense	probably damaging	1.00
R2910:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R2911:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R3736:Ankrd11	UTSW	8	122891785	missense	probably damaging	0.97
R3738:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3739:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3813:Ankrd11	UTSW	8	122891378	missense	probably benign
R4012:Ankrd11	UTSW	8	122892417	missense	probably damaging	0.98
R4183:Ankrd11	UTSW	8	122899676	missense	possibly damaging	0.88
R4213:Ankrd11	UTSW	8	122891026	missense	probably benign	0.00
R4469:Ankrd11	UTSW	8	122896587	missense	probably damaging	1.00
R4482:Ankrd11	UTSW	8	122893489	missense	probably damaging	1.00
R4935:Ankrd11	UTSW	8	122900183	missense	probably benign	0.02
R4940:Ankrd11	UTSW	8	122889821	missense	probably damaging	1.00
R5145:Ankrd11	UTSW	8	122891204	utr 3 prime	probably benign
R5154:Ankrd11	UTSW	8	122893139	missense	probably damaging	1.00
R5230:Ankrd11	UTSW	8	122890477	missense	probably benign	0.11
R5283:Ankrd11	UTSW	8	122884182	missense	probably damaging	1.00
R5377:Ankrd11	UTSW	8	122893714	splice site	probably null
R5513:Ankrd11	UTSW	8	122892520	missense	probably benign	0.38
R5518:Ankrd11	UTSW	8	122890994	missense	possibly damaging	0.93
R5549:Ankrd11	UTSW	8	122890378	missense	probably benign	0.02
R5579:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R5595:Ankrd11	UTSW	8	122894304	nonsense	probably null
R5650:Ankrd11	UTSW	8	122887397	missense	probably damaging	0.99
R5717:Ankrd11	UTSW	8	122892638	missense	possibly damaging	0.92
R5753:Ankrd11	UTSW	8	122895304	missense	possibly damaging	0.90
R5782:Ankrd11	UTSW	8	122900017	missense	probably damaging	1.00
R5812:Ankrd11	UTSW	8	122893805	splice site	probably null
R5823:Ankrd11	UTSW	8	122895790	missense	probably benign	0.12
R5900:Ankrd11	UTSW	8	122891066	missense	probably benign	0.00
R5975:Ankrd11	UTSW	8	122889749	missense	possibly damaging	0.93
R5979:Ankrd11	UTSW	8	122892400	missense	probably damaging	1.00
R6000:Ankrd11	UTSW	8	122891195	missense	possibly damaging	0.73
R6145:Ankrd11	UTSW	8	122892661	missense	probably damaging	1.00
R6252:Ankrd11	UTSW	8	122893822	missense	possibly damaging	0.87
R6302:Ankrd11	UTSW	8	122889989	missense	probably benign
R6457:Ankrd11	UTSW	8	122908764	missense	probably damaging	1.00
R6513:Ankrd11	UTSW	8	122890180	missense	probably benign	0.02
R6582:Ankrd11	UTSW	8	122891629	missense	probably benign	0.00
R6738:Ankrd11	UTSW	8	122891921	missense	probably damaging	0.99
R6865:Ankrd11	UTSW	8	122894944	missense	probably benign	0.41
R6913:Ankrd11	UTSW	8	122894911	missense	probably benign	0.01
R7101:Ankrd11	UTSW	8	122895455	missense	probably benign	0.35
R7116:Ankrd11	UTSW	8	122896130	missense	probably damaging	1.00
R7477:Ankrd11	UTSW	8	122894385	missense	possibly damaging	0.91
R7534:Ankrd11	UTSW	8	122894410	missense	probably damaging	1.00
R7555:Ankrd11	UTSW	8	122887406	missense	probably damaging	0.99
R7627:Ankrd11	UTSW	8	122890951	missense	possibly damaging	0.63
R7658:Ankrd11	UTSW	8	122893664	missense	probably benign
R7721:Ankrd11	UTSW	8	122894759	missense	probably damaging	1.00
R7731:Ankrd11	UTSW	8	122895433	missense	probably benign	0.12
R7792:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R7924:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R7939:Ankrd11	UTSW	8	122891073	missense	probably damaging	1.00
R8022:Ankrd11	UTSW	8	122887593	missense	probably damaging	1.00
R8222:Ankrd11	UTSW	8	122895608	missense	probably damaging	0.98
R8362:Ankrd11	UTSW	8	122892058	missense	probably damaging	0.96
R8430:Ankrd11	UTSW	8	122893366	missense	probably benign	0.01
R8726:Ankrd11	UTSW	8	122894026	missense	possibly damaging	0.90
R8888:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8895:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8928:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8930:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8931:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8936:Ankrd11	UTSW	8	122895101	missense	possibly damaging	0.69
R9018:Ankrd11	UTSW	8	122895512	missense	probably damaging	1.00
R9113:Ankrd11	UTSW	8	122887333	missense	possibly damaging	0.60
R9399:Ankrd11	UTSW	8	122891440	missense	probably benign
RF019:Ankrd11	UTSW	8	122896634	missense	probably damaging	1.00
Z1176:Ankrd11	UTSW	8	122895803	missense	possibly damaging	0.68
Z1177:Ankrd11	UTSW	8	122900142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTCCAATGTTCTGGGGC -3'
(R):5'- GCACTTCACTGGTTGGTTCC -3'

Sequencing Primer
(F):5'- AATGTTCTGGGGCCCACC -3'
(R):5'- GCTCTACTTGGCAGTGGTCC -3'

Posted On

2020-10-20