Incidental Mutation 'R8511:Scn11a'
ID 655881
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 067888-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119618981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 787 (K787R)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: K787R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: K787R

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: K787R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,540,056 (GRCm39) H186R unknown Het
6430548M08Rik A G 8: 120,879,301 (GRCm39) N233S probably benign Het
Acan A G 7: 78,747,683 (GRCm39) D818G possibly damaging Het
Adam22 G A 5: 8,184,558 (GRCm39) T478I probably damaging Het
Afg2a A G 3: 37,490,897 (GRCm39) M481V probably damaging Het
Agmo T A 12: 37,294,396 (GRCm39) *115R probably null Het
Ahnak A G 19: 8,989,719 (GRCm39) K3668E unknown Het
Aldh6a1 G A 12: 84,480,745 (GRCm39) T430I possibly damaging Het
Ankrd11 T C 8: 123,626,468 (GRCm39) D17G Het
Apol10b T C 15: 77,469,211 (GRCm39) E322G probably benign Het
Apol10b C G 15: 77,469,210 (GRCm39) E322D probably benign Het
Apol8 C T 15: 77,634,273 (GRCm39) G101E probably benign Het
Arhgef26 A T 3: 62,336,350 (GRCm39) M630L probably damaging Het
Aspm T C 1: 139,385,046 (GRCm39) L230P probably damaging Het
Atg101 T C 15: 101,188,503 (GRCm39) S203P probably damaging Het
Baz2b T A 2: 59,732,158 (GRCm39) T1996S probably benign Het
Brwd1 A T 16: 95,859,938 (GRCm39) M350K probably damaging Het
Cad A G 5: 31,233,165 (GRCm39) K1869R probably benign Het
Caskin1 A T 17: 24,724,910 (GRCm39) I1233F probably benign Het
Ckap5 T A 2: 91,445,492 (GRCm39) L1770I possibly damaging Het
Clip1 T C 5: 123,791,969 (GRCm39) N67S possibly damaging Het
Csmd2 A G 4: 128,262,692 (GRCm39) N626S Het
Cuedc2 C A 19: 46,319,358 (GRCm39) probably null Het
Dmbt1 A T 7: 130,703,742 (GRCm39) N1275Y unknown Het
Dnm3 A G 1: 162,113,611 (GRCm39) V483A possibly damaging Het
Dock9 A T 14: 121,864,801 (GRCm39) H718Q probably benign Het
Dock9 T C 14: 121,918,847 (GRCm39) D50G probably damaging Het
Egfr T G 11: 16,846,949 (GRCm39) I782S probably damaging Het
Elmod1 A T 9: 53,820,095 (GRCm39) F298I probably damaging Het
Enthd1 T C 15: 80,358,428 (GRCm39) Q364R probably damaging Het
Fat2 T A 11: 55,200,063 (GRCm39) S1004C probably damaging Het
Fga A T 3: 82,939,064 (GRCm39) K480* probably null Het
Fhod3 A G 18: 25,265,994 (GRCm39) T1561A probably damaging Het
Foxg1 T A 12: 49,431,868 (GRCm39) Y200* probably null Het
Foxj2 C T 6: 122,808,404 (GRCm39) R115* probably null Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gpsm2 A G 3: 108,589,399 (GRCm39) S580P probably benign Het
Hectd1 A G 12: 51,834,654 (GRCm39) S870P probably benign Het
Hic2 T A 16: 17,075,874 (GRCm39) N234K possibly damaging Het
Ica1 A G 6: 8,754,726 (GRCm39) F15L probably benign Het
Immp1l G A 2: 105,761,100 (GRCm39) R3H probably benign Het
Iqca1l T A 5: 24,750,906 (GRCm39) H559L possibly damaging Het
Jak3 T A 8: 72,138,194 (GRCm39) Y882N probably damaging Het
Klk1b1 C T 7: 43,619,767 (GRCm39) R109C possibly damaging Het
Luzp1 A G 4: 136,268,650 (GRCm39) D291G probably damaging Het
Map3k19 C T 1: 127,775,155 (GRCm39) E61K possibly damaging Het
Mical3 A G 6: 121,015,513 (GRCm39) I175T possibly damaging Het
Nectin3 G A 16: 46,284,363 (GRCm39) P107L probably damaging Het
Or10d5 A G 9: 39,861,455 (GRCm39) V204A probably benign Het
Pira1 A G 7: 3,742,347 (GRCm39) L60P probably damaging Het
Polr1a C A 6: 71,897,504 (GRCm39) H207N probably benign Het
Prokr2 A G 2: 132,223,422 (GRCm39) V40A probably benign Het
Prtg T C 9: 72,798,156 (GRCm39) probably null Het
Ptprs G A 17: 56,754,440 (GRCm39) T200I probably damaging Het
Ramp3 C T 11: 6,626,709 (GRCm39) R139C probably benign Het
Scfd2 A G 5: 74,372,949 (GRCm39) V642A possibly damaging Het
Slco3a1 A G 7: 73,952,990 (GRCm39) V523A probably benign Het
Smo A G 6: 29,755,531 (GRCm39) Y401C probably damaging Het
Stmn2 A G 3: 8,574,615 (GRCm39) probably benign Het
Stra6l G T 4: 45,885,347 (GRCm39) G605V probably benign Het
Syne2 A G 12: 76,055,647 (GRCm39) I4170V probably benign Het
Tgm7 T A 2: 120,924,141 (GRCm39) I594F probably damaging Het
Tle2 T C 10: 81,423,830 (GRCm39) L648P probably damaging Het
Tmprss2 G T 16: 97,369,662 (GRCm39) L371I possibly damaging Het
Ttn T C 2: 76,579,866 (GRCm39) R23676G probably damaging Het
Tvp23b T C 11: 62,774,563 (GRCm39) I69T possibly damaging Het
Vmn2r66 A T 7: 84,656,026 (GRCm39) I330N probably damaging Het
Vmn2r99 A T 17: 19,614,443 (GRCm39) D721V probably damaging Het
Zan A T 5: 137,445,108 (GRCm39) V1717E unknown Het
Zmiz2 C T 11: 6,353,190 (GRCm39) H658Y probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAATAACAATGCTCACTAGTGAAG -3'
(R):5'- GCCAAGTTTAACAAGACTTGCTC -3'

Sequencing Primer
(F):5'- GAATCAGTGCCTTCTGGACACAG -3'
(R):5'- AGTTTAACAAGACTTGCTCCACCTC -3'
Posted On 2020-10-20