Incidental Mutation 'R8511:Ggnbp2'
ID 655889
Institutional Source Beutler Lab
Gene Symbol Ggnbp2
Ensembl Gene ENSMUSG00000020530
Gene Name gametogenetin binding protein 2
Synonyms Zfp403, DIF-3, D330017P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84832361-84870817 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) C to T at 84837989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018547] [ENSMUST00000100686] [ENSMUST00000108081] [ENSMUST00000154915] [ENSMUST00000168434] [ENSMUST00000170741] [ENSMUST00000172405]
AlphaFold Q5SV77
Predicted Effect probably null
Transcript: ENSMUST00000018547
SMART Domains Protein: ENSMUSP00000018547
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 179 185 N/A INTRINSIC
coiled coil region 393 426 N/A INTRINSIC
low complexity region 570 584 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100686
SMART Domains Protein: ENSMUSP00000098252
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
coiled coil region 351 388 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108081
SMART Domains Protein: ENSMUSP00000103716
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132098
SMART Domains Protein: ENSMUSP00000129898
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154915
SMART Domains Protein: ENSMUSP00000117482
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168434
SMART Domains Protein: ENSMUSP00000130013
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170741
SMART Domains Protein: ENSMUSP00000128109
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 99 113 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172405
SMART Domains Protein: ENSMUSP00000127584
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality throughout fetal growth and development associated with pallor and alterations in placental labyrinth vasculature morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Ggnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ggnbp2 APN 11 84840404 missense possibly damaging 0.49
IGL02095:Ggnbp2 APN 11 84833128 missense probably damaging 1.00
IGL02366:Ggnbp2 APN 11 84841601 missense probably damaging 1.00
IGL02548:Ggnbp2 APN 11 84862286 missense possibly damaging 0.78
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0375:Ggnbp2 UTSW 11 84836374 nonsense probably null
R0415:Ggnbp2 UTSW 11 84833225 splice site probably benign
R0433:Ggnbp2 UTSW 11 84836420 missense probably damaging 1.00
R0589:Ggnbp2 UTSW 11 84836451 missense probably damaging 1.00
R0970:Ggnbp2 UTSW 11 84862312 missense possibly damaging 0.83
R1413:Ggnbp2 UTSW 11 84833129 missense probably damaging 1.00
R1912:Ggnbp2 UTSW 11 84862296 missense probably benign 0.02
R1997:Ggnbp2 UTSW 11 84860561 missense probably damaging 1.00
R2161:Ggnbp2 UTSW 11 84834433 missense probably benign 0.08
R2220:Ggnbp2 UTSW 11 84836613 missense possibly damaging 0.46
R2879:Ggnbp2 UTSW 11 84832971 splice site probably null
R2941:Ggnbp2 UTSW 11 84841581 missense probably damaging 1.00
R3726:Ggnbp2 UTSW 11 84854094 missense possibly damaging 0.93
R4662:Ggnbp2 UTSW 11 84862246 missense probably damaging 1.00
R4771:Ggnbp2 UTSW 11 84834488 missense probably benign 0.00
R5212:Ggnbp2 UTSW 11 84854021 intron probably benign
R5310:Ggnbp2 UTSW 11 84869968 start codon destroyed probably null 1.00
R5479:Ggnbp2 UTSW 11 84854343 missense probably benign
R5924:Ggnbp2 UTSW 11 84858537 missense possibly damaging 0.61
R6212:Ggnbp2 UTSW 11 84836677 missense possibly damaging 0.94
R6700:Ggnbp2 UTSW 11 84840105 missense probably damaging 1.00
R6931:Ggnbp2 UTSW 11 84833167 missense probably damaging 1.00
R7031:Ggnbp2 UTSW 11 84860641 missense probably damaging 1.00
R7493:Ggnbp2 UTSW 11 84854073 missense probably benign 0.21
R7694:Ggnbp2 UTSW 11 84860713 missense possibly damaging 0.94
R7761:Ggnbp2 UTSW 11 84839977 splice site probably null
R8257:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8355:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8419:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8512:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8532:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8534:Ggnbp2 UTSW 11 84837989 critical splice acceptor site probably null
R8551:Ggnbp2 UTSW 11 84841525 nonsense probably null
R8695:Ggnbp2 UTSW 11 84869941 missense possibly damaging 0.81
R8705:Ggnbp2 UTSW 11 84862306 missense possibly damaging 0.82
R8864:Ggnbp2 UTSW 11 84840076 missense probably damaging 1.00
R9055:Ggnbp2 UTSW 11 84841622 missense probably damaging 1.00
R9142:Ggnbp2 UTSW 11 84840060 missense possibly damaging 0.96
R9324:Ggnbp2 UTSW 11 84834348 missense probably damaging 1.00
Z1187:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1188:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1189:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1190:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Z1192:Ggnbp2 UTSW 11 84836652 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTCCACAGGACCCAGGGT -3'
(R):5'- CTCCTGTCTCAAATGCTGGGATTA -3'

Sequencing Primer
(F):5'- TAAAGGTGTGTGTCAACATGCCC -3'
(R):5'- CTGGGATTACTGACATGAGCCTC -3'
Posted On 2020-10-20