Incidental Mutation 'R8511:Foxg1'
ID 655891
Institutional Source Beutler Lab
Gene Symbol Foxg1
Ensembl Gene ENSMUSG00000020950
Gene Name forkhead box G1
Synonyms Hfh9, BF-1, 2900064B05Rik, Hfhbf1, Bf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 49382660-49386861 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 49385085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 200 (Y200*)
Ref Sequence ENSEMBL: ENSMUSP00000021333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021333] [ENSMUST00000179669]
AlphaFold Q60987
Predicted Effect probably null
Transcript: ENSMUST00000021333
AA Change: Y200*
SMART Domains Protein: ENSMUSP00000021333
Gene: ENSMUSG00000020950
AA Change: Y200*

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110746
SMART Domains Protein: ENSMUSP00000106374
Gene: ENSMUSG00000089922

DomainStartEndE-ValueType
low complexity region 120 131 N/A INTRINSIC
low complexity region 169 198 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179669
AA Change: Y200*
SMART Domains Protein: ENSMUSP00000136372
Gene: ENSMUSG00000020950
AA Change: Y200*

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutants exhibit dramatically reduced cerebral hemispheres, missing ventral telencephalic structures, impaired migration of efferent thalamocortical axons, and multiple eye defects. Mutants die at birth from respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Foxg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Foxg1 APN 12 49385620 missense possibly damaging 0.94
IGL02629:Foxg1 APN 12 49385548 missense probably benign 0.02
R0267:Foxg1 UTSW 12 49385582 missense probably damaging 1.00
R0486:Foxg1 UTSW 12 49384531 unclassified probably benign
R0646:Foxg1 UTSW 12 49384567 unclassified probably benign
R2110:Foxg1 UTSW 12 49384925 unclassified probably benign
R3784:Foxg1 UTSW 12 49385599 missense probably benign 0.04
R4198:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4199:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4200:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4360:Foxg1 UTSW 12 49384692 small deletion probably benign
R5044:Foxg1 UTSW 12 49385186 missense probably damaging 1.00
R6053:Foxg1 UTSW 12 49385378 missense possibly damaging 0.62
R6277:Foxg1 UTSW 12 49385516 missense probably benign 0.06
R6485:Foxg1 UTSW 12 49385080 missense probably damaging 1.00
R6979:Foxg1 UTSW 12 49384784 unclassified probably benign
R7033:Foxg1 UTSW 12 49384720 unclassified probably benign
R8156:Foxg1 UTSW 12 49384646 missense unknown
R8193:Foxg1 UTSW 12 49385594 missense possibly damaging 0.83
R8789:Foxg1 UTSW 12 49385360 missense probably benign 0.43
R8909:Foxg1 UTSW 12 49384692 small deletion probably benign
R8958:Foxg1 UTSW 12 49385161 missense probably damaging 1.00
R9228:Foxg1 UTSW 12 49384537 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACGCACTTGGAGCCAAAG -3'
(R):5'- AACTCAAAGTGCTGCTGGCG -3'

Sequencing Primer
(F):5'- TCGGGCCGGACGAGAAG -3'
(R):5'- GCGCTTAAAGGCCAGCTTG -3'
Posted On 2020-10-20