Incidental Mutation 'R8511:Fhod3'
ID 655909
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Name formin homology 2 domain containing 3
Synonyms A930009H06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 24709445-25133500 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25132937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1561 (T1561A)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097] [ENSMUST00000115817] [ENSMUST00000148255]
AlphaFold Q76LL6
Predicted Effect probably damaging
Transcript: ENSMUST00000037097
AA Change: T1561A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: T1561A

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115817
SMART Domains Protein: ENSMUSP00000111484
Gene: ENSMUSG00000024269

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
low complexity region 253 264 N/A INTRINSIC
low complexity region 271 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148255
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0570:Fhod3 UTSW 18 25112583 missense probably benign 0.27
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1621:Fhod3 UTSW 18 25022867 missense probably benign 0.35
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4667:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5832:Fhod3 UTSW 18 25090695 missense probably damaging 1.00
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R6414:Fhod3 UTSW 18 25090878 missense possibly damaging 0.64
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7172:Fhod3 UTSW 18 25085546 missense probably damaging 1.00
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
R7432:Fhod3 UTSW 18 25001909 missense possibly damaging 0.95
R7588:Fhod3 UTSW 18 25090248 missense probably benign 0.02
R7629:Fhod3 UTSW 18 24754317 missense probably benign 0.08
R7667:Fhod3 UTSW 18 25001944 missense probably benign
R7681:Fhod3 UTSW 18 24990038 missense probably damaging 1.00
R7829:Fhod3 UTSW 18 25115890 critical splice donor site probably null
R7889:Fhod3 UTSW 18 24770494 missense probably damaging 0.99
R8072:Fhod3 UTSW 18 25020665 small deletion probably benign
R8117:Fhod3 UTSW 18 25115853 missense probably damaging 1.00
R8245:Fhod3 UTSW 18 25113616 missense probably damaging 1.00
R8518:Fhod3 UTSW 18 25056333 missense probably damaging 1.00
R8845:Fhod3 UTSW 18 25132919 missense probably damaging 0.99
R8889:Fhod3 UTSW 18 25056395 critical splice donor site probably null
R8892:Fhod3 UTSW 18 25056395 critical splice donor site probably null
R9016:Fhod3 UTSW 18 25110079 missense possibly damaging 0.90
R9035:Fhod3 UTSW 18 25028083 missense probably benign 0.03
R9063:Fhod3 UTSW 18 25020715 missense probably damaging 0.99
R9157:Fhod3 UTSW 18 25085594 missense probably damaging 0.98
R9201:Fhod3 UTSW 18 24994556 nonsense probably null
R9244:Fhod3 UTSW 18 25115865 missense probably damaging 1.00
R9268:Fhod3 UTSW 18 24709775 critical splice donor site probably null
R9415:Fhod3 UTSW 18 24969187 missense probably damaging 1.00
Z1177:Fhod3 UTSW 18 25020706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTTGCAATCTCGAGGTC -3'
(R):5'- GTGACAAGCAGTGTGTTACTCAG -3'

Sequencing Primer
(F):5'- AATCTCGAGGTCTCTCCCTGGG -3'
(R):5'- GTGTGTTACTCAGAAATGAGGACTC -3'
Posted On 2020-10-20