Incidental Mutation 'R8512:Ptprt'
ID 655920
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase, receptor type, T
Synonyms RPTPrho
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R8512 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 161521990-162661147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 161558863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1085 (F1085L)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109441
AA Change: F1085L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: F1085L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109442
AA Change: F1084L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: F1084L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: F1075L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: F1075L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: F1065L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: F1065L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,818,760 probably null Het
Akap13 T C 7: 75,611,086 S350P probably damaging Het
Celsr2 A G 3: 108,413,838 F553L probably damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chtf8 G A 8: 106,885,434 T291I probably benign Het
Ckmt1 A T 2: 121,361,208 R286S probably damaging Het
Dnajb2 C T 1: 75,241,431 R191W Het
Dtnbp1 G T 13: 44,922,391 A292E probably benign Het
Esrrg T G 1: 188,043,580 Y101* probably null Het
Etaa1 G A 11: 17,947,442 S225L probably damaging Het
Evi5l A G 8: 4,193,121 Y335C probably benign Het
Fcho2 T C 13: 98,755,222 D344G possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm12569 T A 11: 51,234,660 S137T probably benign Het
Gsdmc2 C T 15: 63,835,015 V101I probably null Het
Gsdmc4 A G 15: 63,891,959 C430R probably damaging Het
Irak4 A C 15: 94,566,778 I410L probably benign Het
Kirrel A G 3: 87,088,227 V436A probably benign Het
Lrrc30 T A 17: 67,631,952 Q211L probably damaging Het
Map4k1 C T 7: 28,996,158 H512Y possibly damaging Het
Matn3 T A 12: 8,961,183 S365T probably benign Het
Msantd2 T C 9: 37,522,935 I358T possibly damaging Het
Msx3 G T 7: 140,048,971 A10E probably benign Het
Muc16 T C 9: 18,638,192 T5602A probably benign Het
Myh2 T C 11: 67,190,361 S1268P probably benign Het
Mynn C T 3: 30,616,649 P557S probably damaging Het
Naglu T C 11: 101,070,342 V73A probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Olfr119 T A 17: 37,701,180 F170Y probably damaging Het
Olfr790 T A 10: 129,501,627 S240T probably damaging Het
P2rx3 C T 2: 85,024,411 E100K probably damaging Het
Pnisr C T 4: 21,870,372 Q375* probably null Het
Psmb9 C T 17: 34,183,628 C126Y probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rftn2 G A 1: 55,214,165 P93L probably damaging Het
Rtl1 T A 12: 109,594,617 M263L unknown Het
Sec24c T C 14: 20,690,852 V722A possibly damaging Het
Slc2a7 T C 4: 150,163,295 L384P probably benign Het
Slc6a11 T C 6: 114,238,441 L434P probably damaging Het
Sptb T C 12: 76,602,052 E1869G possibly damaging Het
Susd2 G A 10: 75,639,651 T473I probably benign Het
Synpo C T 18: 60,602,411 R821H probably damaging Het
Tdrd9 G A 12: 112,046,193 V1184I probably benign Het
Tle1 T G 4: 72,122,433 K630Q possibly damaging Het
Traf3 A T 12: 111,261,992 T546S probably benign Het
Ttc17 G A 2: 94,371,763 T398M probably damaging Het
Ttn G C 2: 76,868,348 N136K Het
Ttn T C 2: 76,916,767 E4646G probably benign Het
Xbp1 T C 11: 5,524,266 S156P probably damaging Het
Yipf7 C T 5: 69,517,044 V253I probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162278085 missense probably damaging 1.00
R8236:Ptprt UTSW 2 161687068 critical splice donor site probably null
R8308:Ptprt UTSW 2 161927646 missense probably benign 0.00
R8348:Ptprt UTSW 2 161558886 missense probably damaging 1.00
R8362:Ptprt UTSW 2 161551747 missense probably damaging 1.00
R8365:Ptprt UTSW 2 161901531 missense probably benign 0.05
R8448:Ptprt UTSW 2 161558886 missense probably damaging 1.00
R8715:Ptprt UTSW 2 161530543 missense probably damaging 1.00
R9004:Ptprt UTSW 2 161766394 missense probably benign 0.04
R9046:Ptprt UTSW 2 161530441 missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161560186 missense probably damaging 1.00
R9297:Ptprt UTSW 2 161575778 missense probably benign
R9318:Ptprt UTSW 2 161575778 missense probably benign
R9476:Ptprt UTSW 2 161555461 missense probably damaging 1.00
R9510:Ptprt UTSW 2 161555461 missense probably damaging 1.00
R9571:Ptprt UTSW 2 161553812 missense probably benign 0.10
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATTACTGCCATTGTTGTTGGACAG -3'
(R):5'- ACGTCACACTGGGAGAGTAATG -3'

Sequencing Primer
(F):5'- CTTTTCAGAAGGTGGCAAGGCTC -3'
(R):5'- TCACACTGGGAGAGTAATGAAGGAAG -3'
Posted On 2020-10-20