Incidental Mutation 'R8512:Or10al3'
ID 655959
Institutional Source Beutler Lab
Gene Symbol Or10al3
Ensembl Gene ENSMUSG00000059964
Gene Name olfactory receptor family 10 subfamily AL member 3
Synonyms GA_x6K02T2PSCP-2159633-2160598, MOR263-7, Olfr119
MMRRC Submission 067846-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8512 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 38007576-38012611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38012071 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 170 (F170Y)
Ref Sequence ENSEMBL: ENSMUSP00000092919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080483] [ENSMUST00000213732]
AlphaFold Q7TRJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000080483
AA Change: F170Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092919
Gene: ENSMUSG00000059964
AA Change: F170Y

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 1.7e-5 PFAM
Pfam:7tm_1 47 296 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213732
AA Change: F170Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 56,125,760 (GRCm39) probably null Het
Akap13 T C 7: 75,260,834 (GRCm39) S350P probably damaging Het
Celsr2 A G 3: 108,321,154 (GRCm39) F553L probably damaging Het
Ces3a A T 8: 105,784,661 (GRCm39) T548S probably benign Het
Chtf8 G A 8: 107,612,066 (GRCm39) T291I probably benign Het
Ckmt1 A T 2: 121,191,689 (GRCm39) R286S probably damaging Het
Dnajb2 C T 1: 75,218,075 (GRCm39) R191W Het
Dtnbp1 G T 13: 45,075,867 (GRCm39) A292E probably benign Het
Esrrg T G 1: 187,775,777 (GRCm39) Y101* probably null Het
Etaa1 G A 11: 17,897,442 (GRCm39) S225L probably damaging Het
Evi5l A G 8: 4,243,121 (GRCm39) Y335C probably benign Het
Fcho2 T C 13: 98,891,730 (GRCm39) D344G possibly damaging Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gsdmc2 C T 15: 63,706,864 (GRCm39) V101I probably null Het
Gsdmc4 A G 15: 63,763,808 (GRCm39) C430R probably damaging Het
Irak4 A C 15: 94,464,659 (GRCm39) I410L probably benign Het
Kirrel1 A G 3: 86,995,534 (GRCm39) V436A probably benign Het
Lrrc30 T A 17: 67,938,947 (GRCm39) Q211L probably damaging Het
Map4k1 C T 7: 28,695,583 (GRCm39) H512Y possibly damaging Het
Matn3 T A 12: 9,011,183 (GRCm39) S365T probably benign Het
Msantd2 T C 9: 37,434,231 (GRCm39) I358T possibly damaging Het
Msantd5 T A 11: 51,125,487 (GRCm39) S137T probably benign Het
Msx3 G T 7: 139,628,884 (GRCm39) A10E probably benign Het
Muc16 T C 9: 18,549,488 (GRCm39) T5602A probably benign Het
Myh2 T C 11: 67,081,187 (GRCm39) S1268P probably benign Het
Mynn C T 3: 30,670,798 (GRCm39) P557S probably damaging Het
Naglu T C 11: 100,961,168 (GRCm39) V73A probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,324,437 (GRCm39) probably benign Het
Or6c75 T A 10: 129,337,496 (GRCm39) S240T probably damaging Het
P2rx3 C T 2: 84,854,755 (GRCm39) E100K probably damaging Het
Pnisr C T 4: 21,870,372 (GRCm39) Q375* probably null Het
Psmb9 C T 17: 34,402,602 (GRCm39) C126Y probably benign Het
Ptprt A G 2: 161,400,783 (GRCm39) F1085L probably benign Het
Rev3l A G 10: 39,697,534 (GRCm39) Y677C probably damaging Het
Rftn2 G A 1: 55,253,324 (GRCm39) P93L probably damaging Het
Rtl1 T A 12: 109,561,051 (GRCm39) M263L unknown Het
Sec24c T C 14: 20,740,920 (GRCm39) V722A possibly damaging Het
Slc2a7 T C 4: 150,247,752 (GRCm39) L384P probably benign Het
Slc6a11 T C 6: 114,215,402 (GRCm39) L434P probably damaging Het
Sptb T C 12: 76,648,826 (GRCm39) E1869G possibly damaging Het
Susd2 G A 10: 75,475,485 (GRCm39) T473I probably benign Het
Synpo C T 18: 60,735,483 (GRCm39) R821H probably damaging Het
Tdrd9 G A 12: 112,012,627 (GRCm39) V1184I probably benign Het
Tle1 T G 4: 72,040,670 (GRCm39) K630Q possibly damaging Het
Traf3 A T 12: 111,228,426 (GRCm39) T546S probably benign Het
Ttc17 G A 2: 94,202,108 (GRCm39) T398M probably damaging Het
Ttn G C 2: 76,698,692 (GRCm39) N136K Het
Ttn T C 2: 76,747,111 (GRCm39) E4646G probably benign Het
Xbp1 T C 11: 5,474,266 (GRCm39) S156P probably damaging Het
Yipf7 C T 5: 69,674,387 (GRCm39) V253I probably benign Het
Other mutations in Or10al3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Or10al3 APN 17 38,011,883 (GRCm39) missense probably damaging 1.00
IGL03339:Or10al3 APN 17 38,011,682 (GRCm39) missense probably damaging 0.99
R0092:Or10al3 UTSW 17 38,011,696 (GRCm39) missense probably damaging 0.98
R0207:Or10al3 UTSW 17 38,011,949 (GRCm39) nonsense probably null
R0378:Or10al3 UTSW 17 38,011,932 (GRCm39) missense probably damaging 1.00
R0408:Or10al3 UTSW 17 38,012,190 (GRCm39) missense probably benign
R0483:Or10al3 UTSW 17 38,012,188 (GRCm39) missense probably benign 0.01
R1595:Or10al3 UTSW 17 38,012,004 (GRCm39) missense probably benign 0.03
R1901:Or10al3 UTSW 17 38,012,312 (GRCm39) missense probably damaging 1.00
R1902:Or10al3 UTSW 17 38,012,312 (GRCm39) missense probably damaging 1.00
R2845:Or10al3 UTSW 17 38,011,714 (GRCm39) missense probably damaging 1.00
R2846:Or10al3 UTSW 17 38,011,714 (GRCm39) missense probably damaging 1.00
R4356:Or10al3 UTSW 17 38,011,790 (GRCm39) missense probably damaging 0.97
R4381:Or10al3 UTSW 17 38,011,790 (GRCm39) missense probably damaging 0.97
R6744:Or10al3 UTSW 17 38,012,336 (GRCm39) nonsense probably null
R7674:Or10al3 UTSW 17 38,011,573 (GRCm39) missense probably benign 0.03
R7677:Or10al3 UTSW 17 38,011,957 (GRCm39) missense probably damaging 1.00
R7994:Or10al3 UTSW 17 38,012,326 (GRCm39) missense probably damaging 0.99
R8305:Or10al3 UTSW 17 38,012,389 (GRCm39) missense probably benign 0.10
R9300:Or10al3 UTSW 17 38,011,815 (GRCm39) missense probably damaging 1.00
R9760:Or10al3 UTSW 17 38,012,434 (GRCm39) missense probably damaging 1.00
Z1177:Or10al3 UTSW 17 38,011,944 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAAATCTCTCGGGAGGGTTG -3'
(R):5'- ACTGCAACCAAAATTCTGACATAGG -3'

Sequencing Primer
(F):5'- GGGTTGTGCCACACAGATG -3'
(R):5'- GGAATAAATGATCAACAAAAATGGGC -3'
Posted On 2020-10-20