Incidental Mutation 'R8513:Kiz'
ID655968
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8513 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 146870764 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]
Predicted Effect probably null
Transcript: ENSMUST00000099278
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156232
SMART Domains Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoe C A 7: 19,696,640 G226W probably damaging Het
Armc9 T C 1: 86,162,683 F67L probably damaging Het
Bsn T C 9: 108,114,510 I1348V possibly damaging Het
Cdc73 C A 1: 143,617,391 E402* probably null Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Cpt2 G A 4: 107,906,926 A547V probably damaging Het
Cpxm2 A T 7: 132,143,702 H131Q probably benign Het
Ctdp1 G A 18: 80,449,463 L606F possibly damaging Het
Dot1l T C 10: 80,791,426 S1494P possibly damaging Het
Evpl C T 11: 116,229,744 probably null Het
Fgd3 T C 13: 49,263,924 T688A probably benign Het
Galnt3 A T 2: 66,093,720 C401* probably null Het
Gml2 C G 15: 74,824,155 P133A probably damaging Het
Hepacam A G 9: 37,380,634 E86G probably benign Het
Ilf3 A G 9: 21,388,636 E39G possibly damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Myo1e T A 9: 70,320,088 L147H probably damaging Het
Naa15 T A 3: 51,460,023 V539E probably damaging Het
Nlrp6 A C 7: 140,922,830 D283A possibly damaging Het
Ntf5 A G 7: 45,415,755 T104A probably damaging Het
Olfr388-ps1 A G 11: 73,724,322 V234A unknown Het
Pacsin3 A C 2: 91,262,805 N214T probably benign Het
Pcdha6 T C 18: 36,969,176 I474T probably damaging Het
Pcdhgb1 A G 18: 37,680,528 Y24C probably damaging Het
Pde2a A T 7: 101,509,765 N749Y probably damaging Het
Ptpn3 G A 4: 57,270,085 R26* probably null Het
Rab7 T C 6: 88,004,268 Y144C probably benign Het
Ralgps1 T C 2: 33,336,614 S22G probably damaging Het
Setdb2 G A 14: 59,402,390 T668M probably damaging Het
Slit2 T A 5: 48,224,708 C510* probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata2l T C 8: 123,233,699 M284V probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Stab1 C A 14: 31,149,790 probably null Het
Tmem184b A T 15: 79,369,923 S142T probably benign Het
Tmem201 A T 4: 149,727,923 M312K probably damaging Het
Tpp1 A T 7: 105,749,579 D214E possibly damaging Het
Trav7-2 C T 14: 53,391,021 S72F probably damaging Het
Vmn1r37 A G 6: 66,731,836 T149A probably benign Het
Zfp512 T C 5: 31,480,081 S505P probably damaging Het
Zfp942 T C 17: 21,928,301 D449G probably benign Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0284:Kiz UTSW 2 146863810 missense probably benign 0.22
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0767:Kiz UTSW 2 146889051 missense probably damaging 1.00
R0866:Kiz UTSW 2 146856053 splice site probably benign
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2055:Kiz UTSW 2 146891283 missense probably benign 0.10
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4780:Kiz UTSW 2 146889246 missense possibly damaging 0.90
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R6222:Kiz UTSW 2 146891061 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8395:Kiz UTSW 2 146953029 missense possibly damaging 0.79
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ATGCTTGTGAAATTGCCTGATTGC -3'
(R):5'- AGTCCAAGTAACTGTCTTTTGGC -3'

Sequencing Primer
(F):5'- CCTGATTGCCTGTTTTCCAAGGTAAG -3'
(R):5'- TGGAAACATAAAATCCCCCG -3'
Posted On2020-10-20