Incidental Mutation 'R8513:Cpt2'
ID655972
Institutional Source Beutler Lab
Gene Symbol Cpt2
Ensembl Gene ENSMUSG00000028607
Gene Namecarnitine palmitoyltransferase 2
SynonymsCPT II, CPTII
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R8513 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107903981-107923610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107906926 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 547 (A547V)
Ref Sequence ENSEMBL: ENSMUSP00000030345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030345] [ENSMUST00000106719] [ENSMUST00000106720] [ENSMUST00000131644]
Predicted Effect probably damaging
Transcript: ENSMUST00000030345
AA Change: A547V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030345
Gene: ENSMUSG00000028607
AA Change: A547V

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 49 648 1.4e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106719
SMART Domains Protein: ENSMUSP00000102330
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 265 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106720
SMART Domains Protein: ENSMUSP00000102331
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 113 2.1e-21 PFAM
Pfam:Carn_acyltransf 101 214 1.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131644
SMART Domains Protein: ENSMUSP00000114362
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
PDB:4EYW|B 27 88 2e-28 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoe C A 7: 19,696,640 G226W probably damaging Het
Armc9 T C 1: 86,162,683 F67L probably damaging Het
Bsn T C 9: 108,114,510 I1348V possibly damaging Het
Cdc73 C A 1: 143,617,391 E402* probably null Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Cpxm2 A T 7: 132,143,702 H131Q probably benign Het
Ctdp1 G A 18: 80,449,463 L606F possibly damaging Het
Dot1l T C 10: 80,791,426 S1494P possibly damaging Het
Evpl C T 11: 116,229,744 probably null Het
Fgd3 T C 13: 49,263,924 T688A probably benign Het
Galnt3 A T 2: 66,093,720 C401* probably null Het
Gml2 C G 15: 74,824,155 P133A probably damaging Het
Hepacam A G 9: 37,380,634 E86G probably benign Het
Ilf3 A G 9: 21,388,636 E39G possibly damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kiz A G 2: 146,870,764 probably null Het
Myo1e T A 9: 70,320,088 L147H probably damaging Het
Naa15 T A 3: 51,460,023 V539E probably damaging Het
Nlrp6 A C 7: 140,922,830 D283A possibly damaging Het
Ntf5 A G 7: 45,415,755 T104A probably damaging Het
Olfr388-ps1 A G 11: 73,724,322 V234A unknown Het
Pacsin3 A C 2: 91,262,805 N214T probably benign Het
Pcdha6 T C 18: 36,969,176 I474T probably damaging Het
Pcdhgb1 A G 18: 37,680,528 Y24C probably damaging Het
Pde2a A T 7: 101,509,765 N749Y probably damaging Het
Ptpn3 G A 4: 57,270,085 R26* probably null Het
Rab7 T C 6: 88,004,268 Y144C probably benign Het
Ralgps1 T C 2: 33,336,614 S22G probably damaging Het
Setdb2 G A 14: 59,402,390 T668M probably damaging Het
Slit2 T A 5: 48,224,708 C510* probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata2l T C 8: 123,233,699 M284V probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Stab1 C A 14: 31,149,790 probably null Het
Tmem184b A T 15: 79,369,923 S142T probably benign Het
Tmem201 A T 4: 149,727,923 M312K probably damaging Het
Tpp1 A T 7: 105,749,579 D214E possibly damaging Het
Trav7-2 C T 14: 53,391,021 S72F probably damaging Het
Vmn1r37 A G 6: 66,731,836 T149A probably benign Het
Zfp512 T C 5: 31,480,081 S505P probably damaging Het
Zfp942 T C 17: 21,928,301 D449G probably benign Het
Other mutations in Cpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02655:Cpt2 APN 4 107907427 missense probably damaging 1.00
IGL02755:Cpt2 APN 4 107907775 missense probably damaging 1.00
IGL02803:Cpt2 APN 4 107907386 missense probably benign
IGL03066:Cpt2 APN 4 107907986 missense probably benign 0.01
IGL03180:Cpt2 APN 4 107906960 missense probably damaging 1.00
R0037:Cpt2 UTSW 4 107907974 missense probably damaging 0.99
R0046:Cpt2 UTSW 4 107904362 splice site probably null
R0046:Cpt2 UTSW 4 107904362 splice site probably null
R0598:Cpt2 UTSW 4 107906938 missense probably damaging 1.00
R1844:Cpt2 UTSW 4 107904255 missense possibly damaging 0.68
R2432:Cpt2 UTSW 4 107904526 nonsense probably null
R6326:Cpt2 UTSW 4 107914316 missense probably benign 0.00
R6682:Cpt2 UTSW 4 107904430 missense probably damaging 1.00
R6803:Cpt2 UTSW 4 107912664 missense probably damaging 1.00
R7463:Cpt2 UTSW 4 107908157 missense probably damaging 1.00
R7491:Cpt2 UTSW 4 107907142 missense probably damaging 1.00
R7572:Cpt2 UTSW 4 107907548 missense probably damaging 1.00
R7645:Cpt2 UTSW 4 107906974 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTGTCACCCTAGCTTCTGG -3'
(R):5'- CAGTGGCTACCTATGAATCCTGC -3'

Sequencing Primer
(F):5'- CTTCTGGTCGCTAGGGGC -3'
(R):5'- TACCTATGAATCCTGCAGCACTG -3'
Posted On2020-10-20