Incidental Mutation 'R8513:Spata31d1c'
ID655994
Institutional Source Beutler Lab
Gene Symbol Spata31d1c
Ensembl Gene ENSMUSG00000074849
Gene Namespermatogenesis associated 31 subfamily D, member 1C
Synonyms4932441B19Rik, Fam75d1c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8513 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location65033058-65038004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65033177 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 30 (S30I)
Ref Sequence ENSEMBL: ENSMUSP00000097024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099427]
Predicted Effect probably damaging
Transcript: ENSMUST00000099427
AA Change: S30I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: S30I

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:DUF4599 63 148 2.4e-31 PFAM
low complexity region 178 190 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
Pfam:FAM75 380 742 1.4e-120 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoe C A 7: 19,696,640 G226W probably damaging Het
Armc9 T C 1: 86,162,683 F67L probably damaging Het
Bsn T C 9: 108,114,510 I1348V possibly damaging Het
Cdc73 C A 1: 143,617,391 E402* probably null Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Cpt2 G A 4: 107,906,926 A547V probably damaging Het
Cpxm2 A T 7: 132,143,702 H131Q probably benign Het
Ctdp1 G A 18: 80,449,463 L606F possibly damaging Het
Dot1l T C 10: 80,791,426 S1494P possibly damaging Het
Evpl C T 11: 116,229,744 probably null Het
Fgd3 T C 13: 49,263,924 T688A probably benign Het
Galnt3 A T 2: 66,093,720 C401* probably null Het
Gml2 C G 15: 74,824,155 P133A probably damaging Het
Hepacam A G 9: 37,380,634 E86G probably benign Het
Ilf3 A G 9: 21,388,636 E39G possibly damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kiz A G 2: 146,870,764 probably null Het
Myo1e T A 9: 70,320,088 L147H probably damaging Het
Naa15 T A 3: 51,460,023 V539E probably damaging Het
Nlrp6 A C 7: 140,922,830 D283A possibly damaging Het
Ntf5 A G 7: 45,415,755 T104A probably damaging Het
Olfr388-ps1 A G 11: 73,724,322 V234A unknown Het
Pacsin3 A C 2: 91,262,805 N214T probably benign Het
Pcdha6 T C 18: 36,969,176 I474T probably damaging Het
Pcdhgb1 A G 18: 37,680,528 Y24C probably damaging Het
Pde2a A T 7: 101,509,765 N749Y probably damaging Het
Ptpn3 G A 4: 57,270,085 R26* probably null Het
Rab7 T C 6: 88,004,268 Y144C probably benign Het
Ralgps1 T C 2: 33,336,614 S22G probably damaging Het
Setdb2 G A 14: 59,402,390 T668M probably damaging Het
Slit2 T A 5: 48,224,708 C510* probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata2l T C 8: 123,233,699 M284V probably benign Het
Stab1 C A 14: 31,149,790 probably null Het
Tmem184b A T 15: 79,369,923 S142T probably benign Het
Tmem201 A T 4: 149,727,923 M312K probably damaging Het
Tpp1 A T 7: 105,749,579 D214E possibly damaging Het
Trav7-2 C T 14: 53,391,021 S72F probably damaging Het
Vmn1r37 A G 6: 66,731,836 T149A probably benign Het
Zfp512 T C 5: 31,480,081 S505P probably damaging Het
Zfp942 T C 17: 21,928,301 D449G probably benign Het
Other mutations in Spata31d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Spata31d1c APN 13 65036089 missense probably damaging 1.00
IGL02830:Spata31d1c APN 13 65035366 missense probably benign 0.25
IGL02947:Spata31d1c APN 13 65034945 nonsense probably null
IGL03133:Spata31d1c APN 13 65034985 missense probably benign 0.18
IGL03176:Spata31d1c APN 13 65037011 missense probably benign 0.01
IGL03183:Spata31d1c APN 13 65035195 missense possibly damaging 0.86
IGL03206:Spata31d1c APN 13 65035593 missense probably benign 0.41
PIT4382001:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R0054:Spata31d1c UTSW 13 65033062 start gained probably benign
R0959:Spata31d1c UTSW 13 65036315 missense probably damaging 1.00
R1232:Spata31d1c UTSW 13 65036614 missense probably benign
R1347:Spata31d1c UTSW 13 65035388 missense probably benign 0.00
R1381:Spata31d1c UTSW 13 65036554 missense probably benign 0.08
R1573:Spata31d1c UTSW 13 65035069 missense possibly damaging 0.92
R1582:Spata31d1c UTSW 13 65033224 missense probably benign
R1639:Spata31d1c UTSW 13 65036039 missense probably benign
R1716:Spata31d1c UTSW 13 65033216 missense possibly damaging 0.86
R1781:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R1907:Spata31d1c UTSW 13 65035876 missense probably benign 0.03
R2012:Spata31d1c UTSW 13 65035227 missense possibly damaging 0.91
R2152:Spata31d1c UTSW 13 65033965 critical splice donor site probably null
R2211:Spata31d1c UTSW 13 65035939 missense probably benign 0.04
R2571:Spata31d1c UTSW 13 65036384 missense probably damaging 1.00
R2908:Spata31d1c UTSW 13 65033191 missense possibly damaging 0.63
R3978:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3979:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3980:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3981:Spata31d1c UTSW 13 65035111 missense possibly damaging 0.68
R4014:Spata31d1c UTSW 13 65035399 missense probably damaging 0.99
R4255:Spata31d1c UTSW 13 65035688 nonsense probably null
R4255:Spata31d1c UTSW 13 65035717 missense probably benign 0.04
R4592:Spata31d1c UTSW 13 65036060 missense probably damaging 0.99
R4597:Spata31d1c UTSW 13 65035613 nonsense probably null
R4624:Spata31d1c UTSW 13 65036597 missense probably benign
R4641:Spata31d1c UTSW 13 65035048 missense probably benign 0.01
R4863:Spata31d1c UTSW 13 65035790 nonsense probably null
R5084:Spata31d1c UTSW 13 65035130 missense probably damaging 0.98
R5152:Spata31d1c UTSW 13 65035595 missense probably damaging 1.00
R5230:Spata31d1c UTSW 13 65035434 missense probably benign 0.41
R5267:Spata31d1c UTSW 13 65035904 missense probably damaging 0.98
R5615:Spata31d1c UTSW 13 65035264 missense possibly damaging 0.61
R5755:Spata31d1c UTSW 13 65036527 missense probably benign 0.12
R5935:Spata31d1c UTSW 13 65037080 missense possibly damaging 0.68
R6017:Spata31d1c UTSW 13 65035079 missense possibly damaging 0.91
R6131:Spata31d1c UTSW 13 65035671 missense probably benign 0.10
R6359:Spata31d1c UTSW 13 65035592 missense possibly damaging 0.63
R6723:Spata31d1c UTSW 13 65035944 missense probably benign 0.01
R7028:Spata31d1c UTSW 13 65036063 missense probably damaging 0.98
R7336:Spata31d1c UTSW 13 65036128 missense probably damaging 0.99
R7426:Spata31d1c UTSW 13 65035361 missense probably benign
R7552:Spata31d1c UTSW 13 65036123 missense probably damaging 0.98
R7605:Spata31d1c UTSW 13 65035840 missense probably benign 0.00
R7666:Spata31d1c UTSW 13 65036000 missense probably benign 0.01
R8403:Spata31d1c UTSW 13 65036230 missense probably benign 0.42
R8445:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8515:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8523:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8799:Spata31d1c UTSW 13 65036326 missense possibly damaging 0.92
R8817:Spata31d1c UTSW 13 65034562 missense probably damaging 0.98
R8854:Spata31d1c UTSW 13 65035990 missense possibly damaging 0.82
R8917:Spata31d1c UTSW 13 65035615 missense probably benign 0.02
X0022:Spata31d1c UTSW 13 65036927 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCCCTTGCTCTGTGATGCAG -3'
(R):5'- ATGCCCTAGGACAGCAATG -3'

Sequencing Primer
(F):5'- TGATGCAGACCTAGGCCTACAG -3'
(R):5'- TCATGTTTCTGAGACAGACAGGC -3'
Posted On2020-10-20