Incidental Mutation 'R8513:Setdb2'
ID655997
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene NameSET domain, bifurcated 2
SynonymsKMT1F, LOC239122
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R8513 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location59402009-59440884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59402390 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 668 (T668M)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: T684M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: T684M

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: T668M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: T668M

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoe C A 7: 19,696,640 G226W probably damaging Het
Armc9 T C 1: 86,162,683 F67L probably damaging Het
Bsn T C 9: 108,114,510 I1348V possibly damaging Het
Cdc73 C A 1: 143,617,391 E402* probably null Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Cpt2 G A 4: 107,906,926 A547V probably damaging Het
Cpxm2 A T 7: 132,143,702 H131Q probably benign Het
Ctdp1 G A 18: 80,449,463 L606F possibly damaging Het
Dot1l T C 10: 80,791,426 S1494P possibly damaging Het
Evpl C T 11: 116,229,744 probably null Het
Fgd3 T C 13: 49,263,924 T688A probably benign Het
Galnt3 A T 2: 66,093,720 C401* probably null Het
Gml2 C G 15: 74,824,155 P133A probably damaging Het
Hepacam A G 9: 37,380,634 E86G probably benign Het
Ilf3 A G 9: 21,388,636 E39G possibly damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kiz A G 2: 146,870,764 probably null Het
Myo1e T A 9: 70,320,088 L147H probably damaging Het
Naa15 T A 3: 51,460,023 V539E probably damaging Het
Nlrp6 A C 7: 140,922,830 D283A possibly damaging Het
Ntf5 A G 7: 45,415,755 T104A probably damaging Het
Olfr388-ps1 A G 11: 73,724,322 V234A unknown Het
Pacsin3 A C 2: 91,262,805 N214T probably benign Het
Pcdha6 T C 18: 36,969,176 I474T probably damaging Het
Pcdhgb1 A G 18: 37,680,528 Y24C probably damaging Het
Pde2a A T 7: 101,509,765 N749Y probably damaging Het
Ptpn3 G A 4: 57,270,085 R26* probably null Het
Rab7 T C 6: 88,004,268 Y144C probably benign Het
Ralgps1 T C 2: 33,336,614 S22G probably damaging Het
Slit2 T A 5: 48,224,708 C510* probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata2l T C 8: 123,233,699 M284V probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Stab1 C A 14: 31,149,790 probably null Het
Tmem184b A T 15: 79,369,923 S142T probably benign Het
Tmem201 A T 4: 149,727,923 M312K probably damaging Het
Tpp1 A T 7: 105,749,579 D214E possibly damaging Het
Trav7-2 C T 14: 53,391,021 S72F probably damaging Het
Vmn1r37 A G 6: 66,731,836 T149A probably benign Het
Zfp512 T C 5: 31,480,081 S505P probably damaging Het
Zfp942 T C 17: 21,928,301 D449G probably benign Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59413692 splice site probably benign
R8393:Setdb2 UTSW 14 59412731 missense probably benign 0.04
R8700:Setdb2 UTSW 14 59417439 missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59423458 nonsense probably null
R8940:Setdb2 UTSW 14 59409507 missense probably damaging 1.00
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATACTTGATGAGTGCCC -3'
(R):5'- GCAAAACTCCGTTCCACATGG -3'

Sequencing Primer
(F):5'- ATACTTGATGAGTGCCCTTATTTTGC -3'
(R):5'- CCTTCTTACATAGGATTTTGGGAGAC -3'
Posted On2020-10-20