Incidental Mutation 'R8513:Gml2'
ID655998
Institutional Source Beutler Lab
Gene Symbol Gml2
Ensembl Gene ENSMUSG00000068600
Gene Nameglycosylphosphatidylinositol anchored molecule like 2
SynonymsHemt1, hematopoietic cell-specific transcript, HemT, 1700057K19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8513 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location74819071-74834871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 74824155 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 133 (P133A)
Ref Sequence ENSEMBL: ENSMUSP00000094130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000188180]
Predicted Effect probably damaging
Transcript: ENSMUST00000096399
AA Change: P133A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600
AA Change: P133A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.06e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoe C A 7: 19,696,640 G226W probably damaging Het
Armc9 T C 1: 86,162,683 F67L probably damaging Het
Bsn T C 9: 108,114,510 I1348V possibly damaging Het
Cdc73 C A 1: 143,617,391 E402* probably null Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Cpt2 G A 4: 107,906,926 A547V probably damaging Het
Cpxm2 A T 7: 132,143,702 H131Q probably benign Het
Ctdp1 G A 18: 80,449,463 L606F possibly damaging Het
Dot1l T C 10: 80,791,426 S1494P possibly damaging Het
Evpl C T 11: 116,229,744 probably null Het
Fgd3 T C 13: 49,263,924 T688A probably benign Het
Galnt3 A T 2: 66,093,720 C401* probably null Het
Hepacam A G 9: 37,380,634 E86G probably benign Het
Ilf3 A G 9: 21,388,636 E39G possibly damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kiz A G 2: 146,870,764 probably null Het
Myo1e T A 9: 70,320,088 L147H probably damaging Het
Naa15 T A 3: 51,460,023 V539E probably damaging Het
Nlrp6 A C 7: 140,922,830 D283A possibly damaging Het
Ntf5 A G 7: 45,415,755 T104A probably damaging Het
Olfr388-ps1 A G 11: 73,724,322 V234A unknown Het
Pacsin3 A C 2: 91,262,805 N214T probably benign Het
Pcdha6 T C 18: 36,969,176 I474T probably damaging Het
Pcdhgb1 A G 18: 37,680,528 Y24C probably damaging Het
Pde2a A T 7: 101,509,765 N749Y probably damaging Het
Ptpn3 G A 4: 57,270,085 R26* probably null Het
Rab7 T C 6: 88,004,268 Y144C probably benign Het
Ralgps1 T C 2: 33,336,614 S22G probably damaging Het
Setdb2 G A 14: 59,402,390 T668M probably damaging Het
Slit2 T A 5: 48,224,708 C510* probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata2l T C 8: 123,233,699 M284V probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Stab1 C A 14: 31,149,790 probably null Het
Tmem184b A T 15: 79,369,923 S142T probably benign Het
Tmem201 A T 4: 149,727,923 M312K probably damaging Het
Tpp1 A T 7: 105,749,579 D214E possibly damaging Het
Trav7-2 C T 14: 53,391,021 S72F probably damaging Het
Vmn1r37 A G 6: 66,731,836 T149A probably benign Het
Zfp512 T C 5: 31,480,081 S505P probably damaging Het
Zfp942 T C 17: 21,928,301 D449G probably benign Het
Other mutations in Gml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Gml2 APN 15 74824221 nonsense probably null
R0031:Gml2 UTSW 15 74824276 missense probably benign 0.12
R0608:Gml2 UTSW 15 74821386 critical splice donor site probably null
R1087:Gml2 UTSW 15 74824097 missense possibly damaging 0.73
R1130:Gml2 UTSW 15 74821346 missense probably damaging 0.99
R1503:Gml2 UTSW 15 74821352 nonsense probably null
R4408:Gml2 UTSW 15 74824339 intron probably benign
R6802:Gml2 UTSW 15 74824246 missense probably damaging 1.00
R7351:Gml2 UTSW 15 74821376 missense possibly damaging 0.57
R7833:Gml2 UTSW 15 74821368 nonsense probably null
R7910:Gml2 UTSW 15 74820530 critical splice acceptor site probably null
R8695:Gml2 UTSW 15 74824240 missense probably benign 0.05
X0066:Gml2 UTSW 15 74824050 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTAGGTGTGAACATTCGGC -3'
(R):5'- CAAAAGGTGCTCTTGACACTG -3'

Sequencing Primer
(F):5'- GGCTGCTCTATGTTCTCAAGGAC -3'
(R):5'- AAAGGTGCTCTTGACACTGTCTCTG -3'
Posted On2020-10-20