Incidental Mutation 'R8514:Gm597'
ID 656005
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8514 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28778505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 149 (V149M)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably damaging
Transcript: ENSMUST00000059937
AA Change: V149M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: V149M

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,758,541 V543A probably damaging Het
C330027C09Rik T C 16: 48,997,447 V60A possibly damaging Het
Capn1 T C 19: 5,997,824 E403G probably damaging Het
Casp12 T C 9: 5,352,735 F186L probably damaging Het
Ccdc40 A G 11: 119,230,633 Q13R unknown Het
Ckap2l G T 2: 129,285,868 A130E possibly damaging Het
Creld1 C T 6: 113,492,869 R411C probably damaging Het
Dock9 A T 14: 121,658,787 S167T probably benign Het
Emc10 G T 7: 44,493,222 Q99K probably damaging Het
Fam26f G A 10: 34,126,403 T228I possibly damaging Het
Fryl T A 5: 73,085,356 I1287L probably benign Het
Gjc3 T A 5: 137,957,510 Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,503,320 probably benign Het
Golga4 T C 9: 118,555,796 V662A possibly damaging Het
Gpr33 A G 12: 52,023,398 V286A probably benign Het
Htr1d A G 4: 136,443,339 E293G probably damaging Het
Ints6 A G 14: 62,695,717 V847A possibly damaging Het
Iqsec3 A G 6: 121,413,562 C317R unknown Het
Mdn1 T A 4: 32,739,857 Y3704N probably damaging Het
Micall2 C A 5: 139,716,222 R422L probably damaging Het
Mndal T C 1: 173,860,192 D492G possibly damaging Het
Myom2 C T 8: 15,125,153 P1244L possibly damaging Het
Notch1 A G 2: 26,472,169 C1025R probably damaging Het
Nthl1 G A 17: 24,634,115 V98M probably damaging Het
Olfr1145 A T 2: 87,810,710 I297F probably damaging Het
Olfr1234 T C 2: 89,363,229 I67V probably benign Het
Pank3 A G 11: 35,776,359 D101G probably null Het
Phtf2 T C 5: 20,802,032 R178G possibly damaging Het
Pitrm1 T C 13: 6,568,786 probably null Het
Platr25 T C 13: 62,700,772 Y92C probably damaging Het
Plpp1 A T 13: 112,834,928 D43V probably damaging Het
Prg4 G A 1: 150,454,645 T759I unknown Het
Pros1 A G 16: 62,910,109 T321A probably benign Het
Rad50 G A 11: 53,678,939 Q882* probably null Het
Rasa3 A C 8: 13,581,322 F533V probably benign Het
Rgs18 T A 1: 144,754,027 I165F probably damaging Het
Rtl1 C T 12: 109,593,873 V511I possibly damaging Het
Sdc3 A G 4: 130,818,761 T144A unknown Het
Slc9a9 T C 9: 94,936,365 F271L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Tcerg1 T A 18: 42,564,122 D759E probably damaging Het
Tecta A G 9: 42,373,110 L893P probably damaging Het
Tex101 T A 7: 24,668,532 Q167L possibly damaging Het
Tnrc6a C T 7: 123,184,215 R970* probably null Het
Trmt1l T C 1: 151,453,991 S562P probably damaging Het
Ubn1 A G 16: 5,073,399 E546G probably damaging Het
Usp38 T A 8: 80,985,717 Q563L probably benign Het
Vmn1r1 C T 1: 182,157,573 V176I probably benign Het
Vmn2r1 A G 3: 64,086,521 K96R probably benign Het
Vmn2r62 A G 7: 42,764,568 V817A probably benign Het
Wdfy3 A T 5: 101,851,353 C3066S possibly damaging Het
Yeats4 T C 10: 117,215,755 E199G possibly damaging Het
Zcchc11 T A 4: 108,557,357 W44R possibly damaging Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
R9656:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9659:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9661:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9663:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9710:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTCTACGGACCCTACACTGAAAAG -3'
(R):5'- ATATGGCCTGTGGAAAGCCC -3'

Sequencing Primer
(F):5'- GAGGTTTTCTTGTTCCTGAACC -3'
(R):5'- GGAAAGCCCAACTCAGTATCATTTAC -3'
Posted On 2020-10-20