Mutagenetix > Incidental Mutation

Incidental Mutation 'R8514:Trmt1l'

656009

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8514 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 151453991 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 562 (S562P)

Ref Sequence

ENSEMBL: ENSMUSP00000068309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065625
AA Change: S562P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: S562P

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000189655

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190070

SMART Domains

Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

Domain	Start	End	E-Value	Type
Blast:RING	1	35	7e-16	BLAST
PDB:3H8H\|A	73	156	2e-56	PDB

Meta Mutation Damage Score

0.4273

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcam	A	G	7: 19,758,541	V543A	probably damaging	Het
C330027C09Rik	T	C	16: 48,997,447	V60A	possibly damaging	Het
Capn1	T	C	19: 5,997,824	E403G	probably damaging	Het
Casp12	T	C	9: 5,352,735	F186L	probably damaging	Het
Ccdc40	A	G	11: 119,230,633	Q13R	unknown	Het
Ckap2l	G	T	2: 129,285,868	A130E	possibly damaging	Het
Creld1	C	T	6: 113,492,869	R411C	probably damaging	Het
Dock9	A	T	14: 121,658,787	S167T	probably benign	Het
Emc10	G	T	7: 44,493,222	Q99K	probably damaging	Het
Fam26f	G	A	10: 34,126,403	T228I	possibly damaging	Het
Fryl	T	A	5: 73,085,356	I1287L	probably benign	Het
Gjc3	T	A	5: 137,957,510	Y171F	probably damaging	Het
Glrp1	GTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTG	1: 88,503,320		probably benign	Het
Gm597	C	T	1: 28,778,505	V149M	probably damaging	Het
Golga4	T	C	9: 118,555,796	V662A	possibly damaging	Het
Gpr33	A	G	12: 52,023,398	V286A	probably benign	Het
Htr1d	A	G	4: 136,443,339	E293G	probably damaging	Het
Ints6	A	G	14: 62,695,717	V847A	possibly damaging	Het
Iqsec3	A	G	6: 121,413,562	C317R	unknown	Het
Mdn1	T	A	4: 32,739,857	Y3704N	probably damaging	Het
Micall2	C	A	5: 139,716,222	R422L	probably damaging	Het
Mndal	T	C	1: 173,860,192	D492G	possibly damaging	Het
Myom2	C	T	8: 15,125,153	P1244L	possibly damaging	Het
Notch1	A	G	2: 26,472,169	C1025R	probably damaging	Het
Nthl1	G	A	17: 24,634,115	V98M	probably damaging	Het
Olfr1145	A	T	2: 87,810,710	I297F	probably damaging	Het
Olfr1234	T	C	2: 89,363,229	I67V	probably benign	Het
Pank3	A	G	11: 35,776,359	D101G	probably null	Het
Phtf2	T	C	5: 20,802,032	R178G	possibly damaging	Het
Pitrm1	T	C	13: 6,568,786		probably null	Het
Platr25	T	C	13: 62,700,772	Y92C	probably damaging	Het
Plpp1	A	T	13: 112,834,928	D43V	probably damaging	Het
Prg4	G	A	1: 150,454,645	T759I	unknown	Het
Pros1	A	G	16: 62,910,109	T321A	probably benign	Het
Rad50	G	A	11: 53,678,939	Q882*	probably null	Het
Rasa3	A	C	8: 13,581,322	F533V	probably benign	Het
Rgs18	T	A	1: 144,754,027	I165F	probably damaging	Het
Rtl1	C	T	12: 109,593,873	V511I	possibly damaging	Het
Sdc3	A	G	4: 130,818,761	T144A	unknown	Het
Slc9a9	T	C	9: 94,936,365	F271L	probably benign	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Tcerg1	T	A	18: 42,564,122	D759E	probably damaging	Het
Tecta	A	G	9: 42,373,110	L893P	probably damaging	Het
Tex101	T	A	7: 24,668,532	Q167L	possibly damaging	Het
Tnrc6a	C	T	7: 123,184,215	R970*	probably null	Het
Ubn1	A	G	16: 5,073,399	E546G	probably damaging	Het
Usp38	T	A	8: 80,985,717	Q563L	probably benign	Het
Vmn1r1	C	T	1: 182,157,573	V176I	probably benign	Het
Vmn2r1	A	G	3: 64,086,521	K96R	probably benign	Het
Vmn2r62	A	G	7: 42,764,568	V817A	probably benign	Het
Wdfy3	A	T	5: 101,851,353	C3066S	possibly damaging	Het
Yeats4	T	C	10: 117,215,755	E199G	possibly damaging	Het
Zcchc11	T	A	4: 108,557,357	W44R	possibly damaging	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2084:Trmt1l	UTSW	1	151440854	missense	probably damaging	1.00
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2338:Trmt1l	UTSW	1	151428959	intron	probably benign
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R3972:Trmt1l	UTSW	1	151433883	missense	possibly damaging	0.91
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4653:Trmt1l	UTSW	1	151439569	missense	probably benign	0.00
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6060:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7760:Trmt1l	UTSW	1	151442674	missense	possibly damaging	0.93
R7984:Trmt1l	UTSW	1	151435738	missense	probably benign	0.02
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CTGATTTTCAGTATTATTCTAGCCCAT -3'
(R):5'- GAGGGTGACAGGCTTTGC -3'

Sequencing Primer
(F):5'- TTCCAAAGGTCCGGAGTTCAAATC -3'
(R):5'- AGTGTATGCCCAGCACTCTG -3'

Posted On

2020-10-20