Incidental Mutation 'R8514:Trmt1l'
ID 656009
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene Name tRNA methyltransferase 1 like
Synonyms 1190005F20Rik, Trm1-like
MMRRC Submission 067945-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8514 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 151304293-151333912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 151329742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 562 (S562P)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000065625
AA Change: S562P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: S562P

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190070
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Meta Mutation Damage Score 0.4273 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,492,466 (GRCm39) V543A probably damaging Het
Calhm6 G A 10: 34,002,399 (GRCm39) T228I possibly damaging Het
Capn1 T C 19: 6,047,854 (GRCm39) E403G probably damaging Het
Casp12 T C 9: 5,352,735 (GRCm39) F186L probably damaging Het
Ccdc40 A G 11: 119,121,459 (GRCm39) Q13R unknown Het
Cip2a T C 16: 48,817,810 (GRCm39) V60A possibly damaging Het
Ckap2l G T 2: 129,127,788 (GRCm39) A130E possibly damaging Het
Creld1 C T 6: 113,469,830 (GRCm39) R411C probably damaging Het
Dock9 A T 14: 121,896,199 (GRCm39) S167T probably benign Het
Emc10 G T 7: 44,142,646 (GRCm39) Q99K probably damaging Het
Fryl T A 5: 73,242,699 (GRCm39) I1287L probably benign Het
Gjc3 T A 5: 137,955,772 (GRCm39) Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,431,042 (GRCm39) probably benign Het
Golga4 T C 9: 118,384,864 (GRCm39) V662A possibly damaging Het
Gpr33 A G 12: 52,070,181 (GRCm39) V286A probably benign Het
Htr1d A G 4: 136,170,650 (GRCm39) E293G probably damaging Het
Ints6 A G 14: 62,933,166 (GRCm39) V847A possibly damaging Het
Iqsec3 A G 6: 121,390,521 (GRCm39) C317R unknown Het
Mdn1 T A 4: 32,739,857 (GRCm39) Y3704N probably damaging Het
Micall2 C A 5: 139,701,977 (GRCm39) R422L probably damaging Het
Mndal T C 1: 173,687,758 (GRCm39) D492G possibly damaging Het
Myom2 C T 8: 15,175,153 (GRCm39) P1244L possibly damaging Het
Notch1 A G 2: 26,362,181 (GRCm39) C1025R probably damaging Het
Nthl1 G A 17: 24,853,089 (GRCm39) V98M probably damaging Het
Or12e10 A T 2: 87,641,054 (GRCm39) I297F probably damaging Het
Or4a15 T C 2: 89,193,573 (GRCm39) I67V probably benign Het
Pank3 A G 11: 35,667,186 (GRCm39) D101G probably null Het
Phtf2 T C 5: 21,007,030 (GRCm39) R178G possibly damaging Het
Pitrm1 T C 13: 6,618,822 (GRCm39) probably null Het
Platr25 T C 13: 62,848,586 (GRCm39) Y92C probably damaging Het
Plpp1 A T 13: 112,971,462 (GRCm39) D43V probably damaging Het
Prg4 G A 1: 150,330,396 (GRCm39) T759I unknown Het
Pros1 A G 16: 62,730,472 (GRCm39) T321A probably benign Het
Rad50 G A 11: 53,569,766 (GRCm39) Q882* probably null Het
Rasa3 A C 8: 13,631,322 (GRCm39) F533V probably benign Het
Rgs18 T A 1: 144,629,765 (GRCm39) I165F probably damaging Het
Rtl1 C T 12: 109,560,307 (GRCm39) V511I possibly damaging Het
Sdc3 A G 4: 130,546,072 (GRCm39) T144A unknown Het
Slc9a9 T C 9: 94,818,418 (GRCm39) F271L probably benign Het
Snrpa1 G A 7: 65,720,381 (GRCm39) G195R probably benign Het
Spata31e5 C T 1: 28,817,586 (GRCm39) V149M probably damaging Het
Tcerg1 T A 18: 42,697,187 (GRCm39) D759E probably damaging Het
Tecta A G 9: 42,284,406 (GRCm39) L893P probably damaging Het
Tex101 T A 7: 24,367,957 (GRCm39) Q167L possibly damaging Het
Tnrc6a C T 7: 122,783,438 (GRCm39) R970* probably null Het
Tut4 T A 4: 108,414,554 (GRCm39) W44R possibly damaging Het
Ubn1 A G 16: 4,891,263 (GRCm39) E546G probably damaging Het
Usp38 T A 8: 81,712,346 (GRCm39) Q563L probably benign Het
Vmn1r1 C T 1: 181,985,138 (GRCm39) V176I probably benign Het
Vmn2r1 A G 3: 63,993,942 (GRCm39) K96R probably benign Het
Vmn2r62 A G 7: 42,413,992 (GRCm39) V817A probably benign Het
Wdfy3 A T 5: 101,999,219 (GRCm39) C3066S possibly damaging Het
Yeats4 T C 10: 117,051,660 (GRCm39) E199G possibly damaging Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151,318,463 (GRCm39) critical splice donor site probably null
IGL02175:Trmt1l APN 1 151,324,235 (GRCm39) missense probably benign 0.00
IGL02348:Trmt1l APN 1 151,325,757 (GRCm39) missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151,315,282 (GRCm39) missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151,309,536 (GRCm39) splice site probably benign
IGL03150:Trmt1l APN 1 151,329,643 (GRCm39) missense probably benign 0.00
IGL03220:Trmt1l APN 1 151,316,692 (GRCm39) splice site probably benign
Canyonlands UTSW 1 151,329,799 (GRCm39) nonsense probably null
splendiforous UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
IGL03014:Trmt1l UTSW 1 151,333,681 (GRCm39) missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0240:Trmt1l UTSW 1 151,333,205 (GRCm39) unclassified probably benign
R0267:Trmt1l UTSW 1 151,333,426 (GRCm39) unclassified probably benign
R2084:Trmt1l UTSW 1 151,316,605 (GRCm39) missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151,311,594 (GRCm39) critical splice donor site probably null
R2338:Trmt1l UTSW 1 151,304,710 (GRCm39) intron probably benign
R2408:Trmt1l UTSW 1 151,315,267 (GRCm39) missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151,309,581 (GRCm39) missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151,329,696 (GRCm39) missense probably benign 0.14
R3972:Trmt1l UTSW 1 151,309,634 (GRCm39) missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151,330,784 (GRCm39) missense probably benign 0.18
R4361:Trmt1l UTSW 1 151,311,626 (GRCm39) intron probably benign
R4411:Trmt1l UTSW 1 151,327,905 (GRCm39) missense probably benign 0.02
R4419:Trmt1l UTSW 1 151,316,559 (GRCm39) missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151,324,094 (GRCm39) nonsense probably null
R4614:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4617:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4618:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4647:Trmt1l UTSW 1 151,333,632 (GRCm39) missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151,315,320 (GRCm39) missense probably benign 0.00
R4734:Trmt1l UTSW 1 151,318,388 (GRCm39) missense probably benign 0.32
R4873:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R4875:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R5026:Trmt1l UTSW 1 151,316,627 (GRCm39) missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151,330,746 (GRCm39) missense probably benign
R5587:Trmt1l UTSW 1 151,311,455 (GRCm39) intron probably benign
R5872:Trmt1l UTSW 1 151,316,594 (GRCm39) missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151,304,704 (GRCm39) intron probably benign
R6333:Trmt1l UTSW 1 151,329,685 (GRCm39) missense probably benign 0.15
R6906:Trmt1l UTSW 1 151,327,926 (GRCm39) missense probably benign 0.03
R7269:Trmt1l UTSW 1 151,333,539 (GRCm39) missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151,316,591 (GRCm39) missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151,316,639 (GRCm39) missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151,318,425 (GRCm39) missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151,311,489 (GRCm39) missense probably benign 0.02
R8257:Trmt1l UTSW 1 151,304,629 (GRCm39) start codon destroyed probably null
R8286:Trmt1l UTSW 1 151,333,543 (GRCm39) missense probably damaging 1.00
R8439:Trmt1l UTSW 1 151,325,727 (GRCm39) missense probably benign 0.10
R8451:Trmt1l UTSW 1 151,324,039 (GRCm39) missense unknown
R9287:Trmt1l UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
R9423:Trmt1l UTSW 1 151,325,817 (GRCm39) missense possibly damaging 0.90
R9622:Trmt1l UTSW 1 151,304,710 (GRCm39) nonsense probably null
X0039:Trmt1l UTSW 1 151,330,741 (GRCm39) missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151,328,864 (GRCm39) missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTGATTTTCAGTATTATTCTAGCCCAT -3'
(R):5'- GAGGGTGACAGGCTTTGC -3'

Sequencing Primer
(F):5'- TTCCAAAGGTCCGGAGTTCAAATC -3'
(R):5'- AGTGTATGCCCAGCACTCTG -3'
Posted On 2020-10-20