Incidental Mutation 'R8514:Mndal'
ID656010
Institutional Source Beutler Lab
Gene Symbol Mndal
Ensembl Gene ENSMUSG00000090272
Gene Namemyeloid nuclear differentiation antigen like
SynonymsGm2785
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8514 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173849126-173942491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173860192 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 492 (D492G)
Ref Sequence ENSEMBL: ENSMUSP00000140610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111210] [ENSMUST00000186442] [ENSMUST00000188804] [ENSMUST00000190071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111210
AA Change: D492G

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272
AA Change: D492G

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186442
AA Change: D439G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140539
Gene: ENSMUSG00000090272
AA Change: D439G

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
internal_repeat_1 152 166 4.72e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 4.72e-7 PROSPERO
low complexity region 225 237 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
Pfam:HIN 258 427 2.9e-83 PFAM
low complexity region 444 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188804
AA Change: D492G

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140610
Gene: ENSMUSG00000090272
AA Change: D492G

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 480 4.3e-86 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190071
SMART Domains Protein: ENSMUSP00000141055
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
internal_repeat_1 21 35 3.67e-8 PROSPERO
low complexity region 39 69 N/A INTRINSIC
internal_repeat_1 77 91 3.67e-8 PROSPERO
low complexity region 94 106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,758,541 V543A probably damaging Het
C330027C09Rik T C 16: 48,997,447 V60A possibly damaging Het
Capn1 T C 19: 5,997,824 E403G probably damaging Het
Casp12 T C 9: 5,352,735 F186L probably damaging Het
Ccdc40 A G 11: 119,230,633 Q13R unknown Het
Ckap2l G T 2: 129,285,868 A130E possibly damaging Het
Creld1 C T 6: 113,492,869 R411C probably damaging Het
Dock9 A T 14: 121,658,787 S167T probably benign Het
Emc10 G T 7: 44,493,222 Q99K probably damaging Het
Fam26f G A 10: 34,126,403 T228I possibly damaging Het
Fryl T A 5: 73,085,356 I1287L probably benign Het
Gjc3 T A 5: 137,957,510 Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,503,320 probably benign Het
Gm597 C T 1: 28,778,505 V149M probably damaging Het
Golga4 T C 9: 118,555,796 V662A possibly damaging Het
Gpr33 A G 12: 52,023,398 V286A probably benign Het
Htr1d A G 4: 136,443,339 E293G probably damaging Het
Ints6 A G 14: 62,695,717 V847A possibly damaging Het
Iqsec3 A G 6: 121,413,562 C317R unknown Het
Mdn1 T A 4: 32,739,857 Y3704N probably damaging Het
Micall2 C A 5: 139,716,222 R422L probably damaging Het
Myom2 C T 8: 15,125,153 P1244L possibly damaging Het
Notch1 A G 2: 26,472,169 C1025R probably damaging Het
Nthl1 G A 17: 24,634,115 V98M probably damaging Het
Olfr1145 A T 2: 87,810,710 I297F probably damaging Het
Olfr1234 T C 2: 89,363,229 I67V probably benign Het
Pank3 A G 11: 35,776,359 D101G probably null Het
Phtf2 T C 5: 20,802,032 R178G possibly damaging Het
Pitrm1 T C 13: 6,568,786 probably null Het
Platr25 T C 13: 62,700,772 Y92C probably damaging Het
Plpp1 A T 13: 112,834,928 D43V probably damaging Het
Prg4 G A 1: 150,454,645 T759I unknown Het
Pros1 A G 16: 62,910,109 T321A probably benign Het
Rad50 G A 11: 53,678,939 Q882* probably null Het
Rasa3 A C 8: 13,581,322 F533V probably benign Het
Rgs18 T A 1: 144,754,027 I165F probably damaging Het
Rtl1 C T 12: 109,593,873 V511I possibly damaging Het
Sdc3 A G 4: 130,818,761 T144A unknown Het
Slc9a9 T C 9: 94,936,365 F271L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Tcerg1 T A 18: 42,564,122 D759E probably damaging Het
Tecta A G 9: 42,373,110 L893P probably damaging Het
Tex101 T A 7: 24,668,532 Q167L possibly damaging Het
Tnrc6a C T 7: 123,184,215 R970* probably null Het
Trmt1l T C 1: 151,453,991 S562P probably damaging Het
Ubn1 A G 16: 5,073,399 E546G probably damaging Het
Usp38 T A 8: 80,985,717 Q563L probably benign Het
Vmn1r1 C T 1: 182,157,573 V176I probably benign Het
Vmn2r1 A G 3: 64,086,521 K96R probably benign Het
Vmn2r62 A G 7: 42,764,568 V817A probably benign Het
Wdfy3 A T 5: 101,851,353 C3066S possibly damaging Het
Yeats4 T C 10: 117,215,755 E199G possibly damaging Het
Zcchc11 T A 4: 108,557,357 W44R possibly damaging Het
Other mutations in Mndal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mndal APN 1 173857456 missense possibly damaging 0.68
IGL02309:Mndal APN 1 173874455 missense probably damaging 0.98
IGL02559:Mndal APN 1 173872920 missense probably benign 0.06
IGL02637:Mndal APN 1 173857437 missense possibly damaging 0.63
LCD18:Mndal UTSW 1 173880218 unclassified probably benign
R0076:Mndal UTSW 1 173874447 nonsense probably null
R0123:Mndal UTSW 1 173857513 splice site probably benign
R0134:Mndal UTSW 1 173857513 splice site probably benign
R0225:Mndal UTSW 1 173857513 splice site probably benign
R0976:Mndal UTSW 1 173862845 missense possibly damaging 0.70
R1081:Mndal UTSW 1 173860222 missense probably benign 0.01
R1497:Mndal UTSW 1 173872875 missense probably benign 0.04
R1522:Mndal UTSW 1 173871466 missense possibly damaging 0.68
R1630:Mndal UTSW 1 173874392 missense possibly damaging 0.52
R1874:Mndal UTSW 1 173860367 unclassified probably benign
R4183:Mndal UTSW 1 173875771 missense possibly damaging 0.95
R4544:Mndal UTSW 1 173875664 nonsense probably null
R4545:Mndal UTSW 1 173875664 nonsense probably null
R4907:Mndal UTSW 1 173862690 missense probably damaging 0.99
R5066:Mndal UTSW 1 173875663 missense probably damaging 1.00
R5853:Mndal UTSW 1 173862504 missense probably damaging 0.98
R6208:Mndal UTSW 1 173857422 missense possibly damaging 0.84
R6395:Mndal UTSW 1 173871433 missense possibly damaging 0.73
R6923:Mndal UTSW 1 173884698 splice site probably null
R6933:Mndal UTSW 1 173875683 missense probably damaging 1.00
R7030:Mndal UTSW 1 173875594 missense probably damaging 1.00
R7327:Mndal UTSW 1 173875619 missense unknown
R7648:Mndal UTSW 1 173857395 missense probably benign 0.01
R8130:Mndal UTSW 1 173871545 nonsense probably null
Z1177:Mndal UTSW 1 173874404 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGAAATCTATTTGCATGCCAC -3'
(R):5'- GTTTCCTATGTCTATAACAGGCTTC -3'

Sequencing Primer
(F):5'- GAAATCTATTTGCATGCCACTCTAAC -3'
(R):5'- TGTCTATAACAGGCTTCATATTTTCC -3'
Posted On2020-10-20