Mutagenetix > Incidental Mutation

Incidental Mutation 'R8514:Ckap2l'

656015

Institutional Source

Beutler Lab

Gene Symbol

Ckap2l

Ensembl Gene

ENSMUSG00000048327

Gene Name

cytoskeleton associated protein 2-like

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R8514 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129268210-129297212 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 129285868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 130 (A130E)

Ref Sequence

ENSEMBL: ENSMUSP00000056145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052708]

AlphaFold

Q7TS74

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052708
AA Change: A130E

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: A130E

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
Pfam:CKAP2_C	425	644	3e-32	PFAM
Pfam:CKAP2_C	675	734	6.9e-18	PFAM

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcam	A	G	7: 19,758,541	V543A	probably damaging	Het
C330027C09Rik	T	C	16: 48,997,447	V60A	possibly damaging	Het
Capn1	T	C	19: 5,997,824	E403G	probably damaging	Het
Casp12	T	C	9: 5,352,735	F186L	probably damaging	Het
Ccdc40	A	G	11: 119,230,633	Q13R	unknown	Het
Creld1	C	T	6: 113,492,869	R411C	probably damaging	Het
Dock9	A	T	14: 121,658,787	S167T	probably benign	Het
Emc10	G	T	7: 44,493,222	Q99K	probably damaging	Het
Fam26f	G	A	10: 34,126,403	T228I	possibly damaging	Het
Fryl	T	A	5: 73,085,356	I1287L	probably benign	Het
Gjc3	T	A	5: 137,957,510	Y171F	probably damaging	Het
Glrp1	GTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTG	1: 88,503,320		probably benign	Het
Gm597	C	T	1: 28,778,505	V149M	probably damaging	Het
Golga4	T	C	9: 118,555,796	V662A	possibly damaging	Het
Gpr33	A	G	12: 52,023,398	V286A	probably benign	Het
Htr1d	A	G	4: 136,443,339	E293G	probably damaging	Het
Ints6	A	G	14: 62,695,717	V847A	possibly damaging	Het
Iqsec3	A	G	6: 121,413,562	C317R	unknown	Het
Mdn1	T	A	4: 32,739,857	Y3704N	probably damaging	Het
Micall2	C	A	5: 139,716,222	R422L	probably damaging	Het
Mndal	T	C	1: 173,860,192	D492G	possibly damaging	Het
Myom2	C	T	8: 15,125,153	P1244L	possibly damaging	Het
Notch1	A	G	2: 26,472,169	C1025R	probably damaging	Het
Nthl1	G	A	17: 24,634,115	V98M	probably damaging	Het
Olfr1145	A	T	2: 87,810,710	I297F	probably damaging	Het
Olfr1234	T	C	2: 89,363,229	I67V	probably benign	Het
Pank3	A	G	11: 35,776,359	D101G	probably null	Het
Phtf2	T	C	5: 20,802,032	R178G	possibly damaging	Het
Pitrm1	T	C	13: 6,568,786		probably null	Het
Platr25	T	C	13: 62,700,772	Y92C	probably damaging	Het
Plpp1	A	T	13: 112,834,928	D43V	probably damaging	Het
Prg4	G	A	1: 150,454,645	T759I	unknown	Het
Pros1	A	G	16: 62,910,109	T321A	probably benign	Het
Rad50	G	A	11: 53,678,939	Q882*	probably null	Het
Rasa3	A	C	8: 13,581,322	F533V	probably benign	Het
Rgs18	T	A	1: 144,754,027	I165F	probably damaging	Het
Rtl1	C	T	12: 109,593,873	V511I	possibly damaging	Het
Sdc3	A	G	4: 130,818,761	T144A	unknown	Het
Slc9a9	T	C	9: 94,936,365	F271L	probably benign	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Tcerg1	T	A	18: 42,564,122	D759E	probably damaging	Het
Tecta	A	G	9: 42,373,110	L893P	probably damaging	Het
Tex101	T	A	7: 24,668,532	Q167L	possibly damaging	Het
Tnrc6a	C	T	7: 123,184,215	R970*	probably null	Het
Trmt1l	T	C	1: 151,453,991	S562P	probably damaging	Het
Ubn1	A	G	16: 5,073,399	E546G	probably damaging	Het
Usp38	T	A	8: 80,985,717	Q563L	probably benign	Het
Vmn1r1	C	T	1: 182,157,573	V176I	probably benign	Het
Vmn2r1	A	G	3: 64,086,521	K96R	probably benign	Het
Vmn2r62	A	G	7: 42,764,568	V817A	probably benign	Het
Wdfy3	A	T	5: 101,851,353	C3066S	possibly damaging	Het
Yeats4	T	C	10: 117,215,755	E199G	possibly damaging	Het
Zcchc11	T	A	4: 108,557,357	W44R	possibly damaging	Het

Other mutations in Ckap2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01401:Ckap2l	APN	2	129269216	missense	probably damaging	1.00
IGL02120:Ckap2l	APN	2	129285622	missense	possibly damaging	0.58
IGL03085:Ckap2l	APN	2	129285047	missense	probably benign	0.00
IGL03175:Ckap2l	APN	2	129285517	missense	probably benign	0.01
IGL03333:Ckap2l	APN	2	129296308	splice site	probably null
R0196:Ckap2l	UTSW	2	129285422	missense	probably benign	0.43
R0501:Ckap2l	UTSW	2	129285491	missense	possibly damaging	0.78
R0715:Ckap2l	UTSW	2	129285716	missense	probably benign	0.02
R0834:Ckap2l	UTSW	2	129296304	splice site	probably benign
R1119:Ckap2l	UTSW	2	129272572	splice site	probably benign
R1561:Ckap2l	UTSW	2	129270725	missense	probably benign	0.01
R1677:Ckap2l	UTSW	2	129285167	missense	possibly damaging	0.86
R1823:Ckap2l	UTSW	2	129275579	missense	probably damaging	1.00
R1971:Ckap2l	UTSW	2	129285422	missense	possibly damaging	0.92
R4803:Ckap2l	UTSW	2	129269256	missense	probably damaging	1.00
R5214:Ckap2l	UTSW	2	129285469	missense	probably benign	0.02
R5264:Ckap2l	UTSW	2	129285379	missense	probably benign	0.01
R5297:Ckap2l	UTSW	2	129285370	missense	possibly damaging	0.56
R5535:Ckap2l	UTSW	2	129285842	missense	probably benign	0.00
R5606:Ckap2l	UTSW	2	129286039	missense	probably damaging	0.98
R6327:Ckap2l	UTSW	2	129285494	missense	probably damaging	1.00
R6489:Ckap2l	UTSW	2	129269114	missense	possibly damaging	0.85
R6726:Ckap2l	UTSW	2	129269194	missense	probably damaging	1.00
R7199:Ckap2l	UTSW	2	129285055	missense	probably benign	0.25
R7220:Ckap2l	UTSW	2	129275516	missense	probably damaging	1.00
R7329:Ckap2l	UTSW	2	129285364	missense	possibly damaging	0.56
R7374:Ckap2l	UTSW	2	129284963	missense	probably damaging	1.00
R7383:Ckap2l	UTSW	2	129269252	missense	possibly damaging	0.88
R7484:Ckap2l	UTSW	2	129272535	missense	possibly damaging	0.82
R7611:Ckap2l	UTSW	2	129285680	missense	possibly damaging	0.88
R7868:Ckap2l	UTSW	2	129285289	missense	probably damaging	1.00
R8338:Ckap2l	UTSW	2	129285019	missense	probably damaging	0.99
R8790:Ckap2l	UTSW	2	129269252	missense	possibly damaging	0.88
R9043:Ckap2l	UTSW	2	129284972	missense	probably damaging	0.99
R9215:Ckap2l	UTSW	2	129281906	missense	possibly damaging	0.74
R9496:Ckap2l	UTSW	2	129270675	missense	probably benign	0.37
R9526:Ckap2l	UTSW	2	129269241	nonsense	probably null
RF037:Ckap2l	UTSW	2	129270649	small deletion	probably benign
Z1176:Ckap2l	UTSW	2	129285362	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGATCTGGCTTCTCAGG -3'
(R):5'- TGTTTTCAGACTCCTGGACC -3'

Sequencing Primer
(F):5'- CTTCTCAGGTTTTGGCAGGGC -3'
(R):5'- GATGTTTCCAATCATGTTTTGCCTAG -3'

Posted On

2020-10-20