Incidental Mutation 'R8514:Tut4'
ID 656018
Institutional Source Beutler Lab
Gene Symbol Tut4
Ensembl Gene ENSMUSG00000034610
Gene Name terminal uridylyl transferase 4
Synonyms 9230115F04Rik, Tent3a, 6030404K05Rik, Zcchc11
MMRRC Submission 067945-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8514 (G1)
Quality Score 210.009
Status Validated
Chromosome 4
Chromosomal Location 108316623-108416618 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108414554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 44 (W44R)
Ref Sequence ENSEMBL: ENSMUSP00000116253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043368] [ENSMUST00000097925] [ENSMUST00000128042]
AlphaFold B2RX14
Predicted Effect possibly damaging
Transcript: ENSMUST00000043368
AA Change: W1583R

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044836
Gene: ENSMUSG00000034610
AA Change: W1583R

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 1.2e-13 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 995 1085 4.2e-10 PFAM
Pfam:PAP_assoc 1201 1254 4.7e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1359 1375 3.44e-4 SMART
low complexity region 1398 1412 N/A INTRINSIC
low complexity region 1418 1473 N/A INTRINSIC
low complexity region 1628 1639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097925
AA Change: W1588R

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095538
Gene: ENSMUSG00000034610
AA Change: W1588R

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 8e-14 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 994 1082 6.3e-11 PFAM
Pfam:PAP_assoc 1201 1254 5.2e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1364 1380 3.44e-4 SMART
low complexity region 1403 1417 N/A INTRINSIC
low complexity region 1423 1478 N/A INTRINSIC
low complexity region 1632 1643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128042
AA Change: W44R

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116253
Gene: ENSMUSG00000034610
AA Change: W44R

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial postnatal lethality associated with postnatal growth retardation and reduced circulating insulin-like growth factor I levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,492,466 (GRCm39) V543A probably damaging Het
Calhm6 G A 10: 34,002,399 (GRCm39) T228I possibly damaging Het
Capn1 T C 19: 6,047,854 (GRCm39) E403G probably damaging Het
Casp12 T C 9: 5,352,735 (GRCm39) F186L probably damaging Het
Ccdc40 A G 11: 119,121,459 (GRCm39) Q13R unknown Het
Cip2a T C 16: 48,817,810 (GRCm39) V60A possibly damaging Het
Ckap2l G T 2: 129,127,788 (GRCm39) A130E possibly damaging Het
Creld1 C T 6: 113,469,830 (GRCm39) R411C probably damaging Het
Dock9 A T 14: 121,896,199 (GRCm39) S167T probably benign Het
Emc10 G T 7: 44,142,646 (GRCm39) Q99K probably damaging Het
Fryl T A 5: 73,242,699 (GRCm39) I1287L probably benign Het
Gjc3 T A 5: 137,955,772 (GRCm39) Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,431,042 (GRCm39) probably benign Het
Golga4 T C 9: 118,384,864 (GRCm39) V662A possibly damaging Het
Gpr33 A G 12: 52,070,181 (GRCm39) V286A probably benign Het
Htr1d A G 4: 136,170,650 (GRCm39) E293G probably damaging Het
Ints6 A G 14: 62,933,166 (GRCm39) V847A possibly damaging Het
Iqsec3 A G 6: 121,390,521 (GRCm39) C317R unknown Het
Mdn1 T A 4: 32,739,857 (GRCm39) Y3704N probably damaging Het
Micall2 C A 5: 139,701,977 (GRCm39) R422L probably damaging Het
Mndal T C 1: 173,687,758 (GRCm39) D492G possibly damaging Het
Myom2 C T 8: 15,175,153 (GRCm39) P1244L possibly damaging Het
Notch1 A G 2: 26,362,181 (GRCm39) C1025R probably damaging Het
Nthl1 G A 17: 24,853,089 (GRCm39) V98M probably damaging Het
Or12e10 A T 2: 87,641,054 (GRCm39) I297F probably damaging Het
Or4a15 T C 2: 89,193,573 (GRCm39) I67V probably benign Het
Pank3 A G 11: 35,667,186 (GRCm39) D101G probably null Het
Phtf2 T C 5: 21,007,030 (GRCm39) R178G possibly damaging Het
Pitrm1 T C 13: 6,618,822 (GRCm39) probably null Het
Platr25 T C 13: 62,848,586 (GRCm39) Y92C probably damaging Het
Plpp1 A T 13: 112,971,462 (GRCm39) D43V probably damaging Het
Prg4 G A 1: 150,330,396 (GRCm39) T759I unknown Het
Pros1 A G 16: 62,730,472 (GRCm39) T321A probably benign Het
Rad50 G A 11: 53,569,766 (GRCm39) Q882* probably null Het
Rasa3 A C 8: 13,631,322 (GRCm39) F533V probably benign Het
Rgs18 T A 1: 144,629,765 (GRCm39) I165F probably damaging Het
Rtl1 C T 12: 109,560,307 (GRCm39) V511I possibly damaging Het
Sdc3 A G 4: 130,546,072 (GRCm39) T144A unknown Het
Slc9a9 T C 9: 94,818,418 (GRCm39) F271L probably benign Het
Snrpa1 G A 7: 65,720,381 (GRCm39) G195R probably benign Het
Spata31e5 C T 1: 28,817,586 (GRCm39) V149M probably damaging Het
Tcerg1 T A 18: 42,697,187 (GRCm39) D759E probably damaging Het
Tecta A G 9: 42,284,406 (GRCm39) L893P probably damaging Het
Tex101 T A 7: 24,367,957 (GRCm39) Q167L possibly damaging Het
Tnrc6a C T 7: 122,783,438 (GRCm39) R970* probably null Het
Trmt1l T C 1: 151,329,742 (GRCm39) S562P probably damaging Het
Ubn1 A G 16: 4,891,263 (GRCm39) E546G probably damaging Het
Usp38 T A 8: 81,712,346 (GRCm39) Q563L probably benign Het
Vmn1r1 C T 1: 181,985,138 (GRCm39) V176I probably benign Het
Vmn2r1 A G 3: 63,993,942 (GRCm39) K96R probably benign Het
Vmn2r62 A G 7: 42,413,992 (GRCm39) V817A probably benign Het
Wdfy3 A T 5: 101,999,219 (GRCm39) C3066S possibly damaging Het
Yeats4 T C 10: 117,051,660 (GRCm39) E199G possibly damaging Het
Other mutations in Tut4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tut4 APN 4 108,407,925 (GRCm39) missense probably damaging 1.00
IGL00684:Tut4 APN 4 108,336,663 (GRCm39) missense possibly damaging 0.80
IGL01598:Tut4 APN 4 108,408,017 (GRCm39) unclassified probably benign
IGL01599:Tut4 APN 4 108,370,596 (GRCm39) missense possibly damaging 0.85
IGL02088:Tut4 APN 4 108,369,415 (GRCm39) splice site probably benign
IGL02451:Tut4 APN 4 108,386,473 (GRCm39) nonsense probably null
IGL02667:Tut4 APN 4 108,415,905 (GRCm39) splice site probably benign
IGL03080:Tut4 APN 4 108,363,021 (GRCm39) missense probably damaging 1.00
IGL03374:Tut4 APN 4 108,415,974 (GRCm39) missense probably damaging 1.00
Flatter UTSW 4 108,399,908 (GRCm39) critical splice donor site probably null
Ingratiate UTSW 4 108,369,392 (GRCm39) missense probably damaging 1.00
oedipus UTSW 4 108,406,552 (GRCm39) missense probably damaging 1.00
Please UTSW 4 108,370,083 (GRCm39) nonsense probably null
H8786:Tut4 UTSW 4 108,408,012 (GRCm39) critical splice donor site probably null
IGL02799:Tut4 UTSW 4 108,370,725 (GRCm39) missense probably benign
R0013:Tut4 UTSW 4 108,388,152 (GRCm39) splice site probably benign
R0013:Tut4 UTSW 4 108,388,152 (GRCm39) splice site probably benign
R0051:Tut4 UTSW 4 108,384,201 (GRCm39) missense probably damaging 1.00
R0051:Tut4 UTSW 4 108,384,201 (GRCm39) missense probably damaging 1.00
R0410:Tut4 UTSW 4 108,343,752 (GRCm39) missense probably benign 0.27
R0698:Tut4 UTSW 4 108,412,730 (GRCm39) missense probably benign 0.22
R0745:Tut4 UTSW 4 108,360,152 (GRCm39) splice site probably benign
R1080:Tut4 UTSW 4 108,336,696 (GRCm39) missense possibly damaging 0.82
R1774:Tut4 UTSW 4 108,365,152 (GRCm39) missense probably damaging 1.00
R1809:Tut4 UTSW 4 108,406,552 (GRCm39) missense probably damaging 1.00
R1869:Tut4 UTSW 4 108,386,497 (GRCm39) missense probably damaging 1.00
R1874:Tut4 UTSW 4 108,407,922 (GRCm39) missense probably damaging 1.00
R1958:Tut4 UTSW 4 108,412,903 (GRCm39) missense probably damaging 1.00
R1976:Tut4 UTSW 4 108,336,720 (GRCm39) missense probably benign 0.01
R2034:Tut4 UTSW 4 108,369,392 (GRCm39) missense probably damaging 1.00
R2164:Tut4 UTSW 4 108,360,226 (GRCm39) missense possibly damaging 0.73
R2251:Tut4 UTSW 4 108,377,405 (GRCm39) missense probably damaging 1.00
R3001:Tut4 UTSW 4 108,370,125 (GRCm39) missense probably damaging 1.00
R3002:Tut4 UTSW 4 108,370,125 (GRCm39) missense probably damaging 1.00
R3003:Tut4 UTSW 4 108,370,125 (GRCm39) missense probably damaging 1.00
R4170:Tut4 UTSW 4 108,405,256 (GRCm39) missense probably damaging 1.00
R4667:Tut4 UTSW 4 108,352,356 (GRCm39) missense probably damaging 1.00
R4868:Tut4 UTSW 4 108,406,417 (GRCm39) splice site probably benign
R4989:Tut4 UTSW 4 108,384,042 (GRCm39) unclassified probably benign
R5014:Tut4 UTSW 4 108,384,043 (GRCm39) unclassified probably benign
R5118:Tut4 UTSW 4 108,377,489 (GRCm39) missense possibly damaging 0.92
R5431:Tut4 UTSW 4 108,348,609 (GRCm39) missense probably damaging 1.00
R5645:Tut4 UTSW 4 108,414,570 (GRCm39) missense probably damaging 1.00
R5661:Tut4 UTSW 4 108,370,384 (GRCm39) missense probably benign 0.05
R5877:Tut4 UTSW 4 108,370,120 (GRCm39) missense probably damaging 0.99
R6307:Tut4 UTSW 4 108,412,817 (GRCm39) missense probably damaging 1.00
R6326:Tut4 UTSW 4 108,336,177 (GRCm39) missense probably benign 0.02
R6407:Tut4 UTSW 4 108,415,979 (GRCm39) missense probably damaging 1.00
R6493:Tut4 UTSW 4 108,384,002 (GRCm39) missense probably damaging 1.00
R6587:Tut4 UTSW 4 108,336,646 (GRCm39) missense probably benign
R7215:Tut4 UTSW 4 108,384,205 (GRCm39) missense probably damaging 1.00
R7413:Tut4 UTSW 4 108,406,533 (GRCm39) missense possibly damaging 0.69
R7584:Tut4 UTSW 4 108,336,543 (GRCm39) missense probably benign 0.00
R7872:Tut4 UTSW 4 108,374,715 (GRCm39) missense probably damaging 1.00
R7970:Tut4 UTSW 4 108,343,651 (GRCm39) missense probably benign 0.00
R8214:Tut4 UTSW 4 108,369,347 (GRCm39) missense probably benign 0.00
R8297:Tut4 UTSW 4 108,336,905 (GRCm39) missense possibly damaging 0.86
R8504:Tut4 UTSW 4 108,388,139 (GRCm39) missense probably damaging 1.00
R8557:Tut4 UTSW 4 108,399,908 (GRCm39) critical splice donor site probably null
R8750:Tut4 UTSW 4 108,407,940 (GRCm39) missense probably damaging 1.00
R8805:Tut4 UTSW 4 108,406,575 (GRCm39) missense possibly damaging 0.83
R8903:Tut4 UTSW 4 108,336,408 (GRCm39) missense probably damaging 1.00
R9003:Tut4 UTSW 4 108,400,029 (GRCm39) missense probably damaging 0.98
R9218:Tut4 UTSW 4 108,370,083 (GRCm39) nonsense probably null
R9412:Tut4 UTSW 4 108,414,561 (GRCm39) missense
R9546:Tut4 UTSW 4 108,370,429 (GRCm39) missense probably benign 0.05
R9547:Tut4 UTSW 4 108,370,429 (GRCm39) missense probably benign 0.05
R9721:Tut4 UTSW 4 108,412,778 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GATTAGCCATCTTTGGTATAGCAG -3'
(R):5'- AAGGCCTCCACTGAGATTCC -3'

Sequencing Primer
(F):5'- CTGGATTTAGCATAATGCACA -3'
(R):5'- CCACTGAGATTCCCAGCTC -3'
Posted On 2020-10-20