Incidental Mutation 'R0370:Mtmr1'
ID65602
Institutional Source Beutler Lab
Gene Symbol Mtmr1
Ensembl Gene ENSMUSG00000015214
Gene Namemyotubularin related protein 1
Synonyms
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0370 (G1)
Quality Score97
Status Not validated
ChromosomeX
Chromosomal Location71364760-71419196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71388231 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 125 (V125I)
Ref Sequence ENSEMBL: ENSMUSP00000117342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015358] [ENSMUST00000114601] [ENSMUST00000130909] [ENSMUST00000146213] [ENSMUST00000149323] [ENSMUST00000156756]
Predicted Effect probably benign
Transcript: ENSMUST00000015358
AA Change: V117I

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000015358
Gene: ENSMUSG00000015214
AA Change: V117I

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
GRAM 97 165 2.78e-12 SMART
Pfam:Myotub-related 216 556 6.9e-149 PFAM
low complexity region 649 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114601
AA Change: V117I

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110248
Gene: ENSMUSG00000015214
AA Change: V117I

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
GRAM 97 165 2.78e-12 SMART
Pfam:Myotub-related 217 554 9.9e-147 PFAM
low complexity region 651 663 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000130909
SMART Domains Protein: ENSMUSP00000121342
Gene: ENSMUSG00000015214

DomainStartEndE-ValueType
GRAM 74 142 2.78e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132837
AA Change: V126I
SMART Domains Protein: ENSMUSP00000121165
Gene: ENSMUSG00000015214
AA Change: V126I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 29 36 N/A INTRINSIC
GRAM 107 175 2.78e-12 SMART
Pfam:Myotub-related 227 309 3.9e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138565
Predicted Effect probably damaging
Transcript: ENSMUST00000146213
AA Change: V125I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117342
Gene: ENSMUSG00000015214
AA Change: V125I

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
GRAM 105 173 2.78e-12 SMART
Predicted Effect silent
Transcript: ENSMUST00000149323
SMART Domains Protein: ENSMUSP00000123363
Gene: ENSMUSG00000015214

DomainStartEndE-ValueType
GRAM 57 125 2.78e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156307
Predicted Effect silent
Transcript: ENSMUST00000156756
SMART Domains Protein: ENSMUSP00000115458
Gene: ENSMUSG00000015214

DomainStartEndE-ValueType
GRAM 65 133 2.78e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin related family of proteins. Members of this family contain the consensus sequence for the active site of protein tyrosine phosphatases. Alternatively spliced variants have been described but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous and male mice hemizygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Mtmr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Mtmr1 APN X 71412257 missense possibly damaging 0.55
IGL02647:Mtmr1 APN X 71393333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCCAGTTTGCTTCAACTGC -3'
(R):5'- GAGGTCTATACCCAAACCACAGTGC -3'

Sequencing Primer
(F):5'- GATAATAGCCCAGTGCCTTCTGAG -3'
(R):5'- CAAATTCACTGTCCTGTAGTGTC -3'
Posted On2013-08-08