Incidental Mutation 'R8514:Tnrc6a'
ID656033
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R8514 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 123184215 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 970 (R970*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014]
Predicted Effect probably null
Transcript: ENSMUST00000094053
AA Change: R1469*
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: R1469*

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect probably null
Transcript: ENSMUST00000205760
AA Change: R970*
Predicted Effect probably benign
Transcript: ENSMUST00000206014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206126
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,758,541 V543A probably damaging Het
C330027C09Rik T C 16: 48,997,447 V60A possibly damaging Het
Capn1 T C 19: 5,997,824 E403G probably damaging Het
Casp12 T C 9: 5,352,735 F186L probably damaging Het
Ccdc40 A G 11: 119,230,633 Q13R unknown Het
Ckap2l G T 2: 129,285,868 A130E possibly damaging Het
Creld1 C T 6: 113,492,869 R411C probably damaging Het
Dock9 A T 14: 121,658,787 S167T probably benign Het
Emc10 G T 7: 44,493,222 Q99K probably damaging Het
Fam26f G A 10: 34,126,403 T228I possibly damaging Het
Fryl T A 5: 73,085,356 I1287L probably benign Het
Gjc3 T A 5: 137,957,510 Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,503,320 probably benign Het
Gm597 C T 1: 28,778,505 V149M probably damaging Het
Golga4 T C 9: 118,555,796 V662A possibly damaging Het
Gpr33 A G 12: 52,023,398 V286A probably benign Het
Htr1d A G 4: 136,443,339 E293G probably damaging Het
Ints6 A G 14: 62,695,717 V847A possibly damaging Het
Iqsec3 A G 6: 121,413,562 C317R unknown Het
Mdn1 T A 4: 32,739,857 Y3704N probably damaging Het
Micall2 C A 5: 139,716,222 R422L probably damaging Het
Mndal T C 1: 173,860,192 D492G possibly damaging Het
Myom2 C T 8: 15,125,153 P1244L possibly damaging Het
Notch1 A G 2: 26,472,169 C1025R probably damaging Het
Nthl1 G A 17: 24,634,115 V98M probably damaging Het
Olfr1145 A T 2: 87,810,710 I297F probably damaging Het
Olfr1234 T C 2: 89,363,229 I67V probably benign Het
Pank3 A G 11: 35,776,359 D101G probably null Het
Phtf2 T C 5: 20,802,032 R178G possibly damaging Het
Pitrm1 T C 13: 6,568,786 probably null Het
Platr25 T C 13: 62,700,772 Y92C probably damaging Het
Plpp1 A T 13: 112,834,928 D43V probably damaging Het
Prg4 G A 1: 150,454,645 T759I unknown Het
Pros1 A G 16: 62,910,109 T321A probably benign Het
Rad50 G A 11: 53,678,939 Q882* probably null Het
Rasa3 A C 8: 13,581,322 F533V probably benign Het
Rgs18 T A 1: 144,754,027 I165F probably damaging Het
Rtl1 C T 12: 109,593,873 V511I possibly damaging Het
Sdc3 A G 4: 130,818,761 T144A unknown Het
Slc9a9 T C 9: 94,936,365 F271L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Tcerg1 T A 18: 42,564,122 D759E probably damaging Het
Tecta A G 9: 42,373,110 L893P probably damaging Het
Tex101 T A 7: 24,668,532 Q167L possibly damaging Het
Trmt1l T C 1: 151,453,991 S562P probably damaging Het
Ubn1 A G 16: 5,073,399 E546G probably damaging Het
Usp38 T A 8: 80,985,717 Q563L probably benign Het
Vmn1r1 C T 1: 182,157,573 V176I probably benign Het
Vmn2r1 A G 3: 64,086,521 K96R probably benign Het
Vmn2r62 A G 7: 42,764,568 V817A probably benign Het
Wdfy3 A T 5: 101,851,353 C3066S possibly damaging Het
Yeats4 T C 10: 117,215,755 E199G possibly damaging Het
Zcchc11 T A 4: 108,557,357 W44R possibly damaging Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7500:Tnrc6a UTSW 7 123173450 splice site probably null
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R8270:Tnrc6a UTSW 7 123170071 missense possibly damaging 0.92
R8313:Tnrc6a UTSW 7 123170713 missense possibly damaging 0.92
R8348:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8390:Tnrc6a UTSW 7 123162571 missense probably damaging 0.97
R8448:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 123162496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCATAGCTACAAGCCAGGC -3'
(R):5'- TGTGTCTCTGCAACACAGC -3'

Sequencing Primer
(F):5'- TACAAGCCAGGCCCCTG -3'
(R):5'- CTACTTGGAAGTTTCTGGAAAAGCAG -3'
Posted On2020-10-20