Mutagenetix > Incidental Mutation

Incidental Mutation 'R8514:Tnrc6a'

656033

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6a

Ensembl Gene

ENSMUSG00000052707

Gene Name

trinucleotide repeat containing 6a

Synonyms

CAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik

MMRRC Submission

Accession Numbers

Genbank: NM_144925; MGI: 2385292

Essential gene?

Probably essential (E-score: 0.850) question?

Stock #

R8514 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123123885-123195296 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 123184215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 970 (R970*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014]

AlphaFold

Q3UHK8

Predicted Effect

probably null
Transcript: ENSMUST00000094053
AA Change: R1469*

SMART Domains

Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: R1469*

Domain	Start	End	E-Value	Type
coiled coil region	5	54	N/A	INTRINSIC
low complexity region	69	92	N/A	INTRINSIC
low complexity region	93	113	N/A	INTRINSIC
low complexity region	281	294	N/A	INTRINSIC
low complexity region	430	443	N/A	INTRINSIC
low complexity region	568	590	N/A	INTRINSIC
internal_repeat_1	690	853	3.51e-6	PROSPERO
low complexity region	858	871	N/A	INTRINSIC
Pfam:Ago_hook	1028	1190	1.2e-29	PFAM
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1301	1316	N/A	INTRINSIC
low complexity region	1337	1376	N/A	INTRINSIC
low complexity region	1386	1392	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1439	1714	1.5e-126	PFAM
RRM	1717	1784	4.95e-2	SMART
low complexity region	1808	1820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205514

Predicted Effect

probably null
Transcript: ENSMUST00000205760
AA Change: R970*

Predicted Effect

probably benign
Transcript: ENSMUST00000206014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206126

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]

Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcam	A	G	7: 19,758,541	V543A	probably damaging	Het
C330027C09Rik	T	C	16: 48,997,447	V60A	possibly damaging	Het
Capn1	T	C	19: 5,997,824	E403G	probably damaging	Het
Casp12	T	C	9: 5,352,735	F186L	probably damaging	Het
Ccdc40	A	G	11: 119,230,633	Q13R	unknown	Het
Ckap2l	G	T	2: 129,285,868	A130E	possibly damaging	Het
Creld1	C	T	6: 113,492,869	R411C	probably damaging	Het
Dock9	A	T	14: 121,658,787	S167T	probably benign	Het
Emc10	G	T	7: 44,493,222	Q99K	probably damaging	Het
Fam26f	G	A	10: 34,126,403	T228I	possibly damaging	Het
Fryl	T	A	5: 73,085,356	I1287L	probably benign	Het
Gjc3	T	A	5: 137,957,510	Y171F	probably damaging	Het
Glrp1	GTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTG	1: 88,503,320		probably benign	Het
Gm597	C	T	1: 28,778,505	V149M	probably damaging	Het
Golga4	T	C	9: 118,555,796	V662A	possibly damaging	Het
Gpr33	A	G	12: 52,023,398	V286A	probably benign	Het
Htr1d	A	G	4: 136,443,339	E293G	probably damaging	Het
Ints6	A	G	14: 62,695,717	V847A	possibly damaging	Het
Iqsec3	A	G	6: 121,413,562	C317R	unknown	Het
Mdn1	T	A	4: 32,739,857	Y3704N	probably damaging	Het
Micall2	C	A	5: 139,716,222	R422L	probably damaging	Het
Mndal	T	C	1: 173,860,192	D492G	possibly damaging	Het
Myom2	C	T	8: 15,125,153	P1244L	possibly damaging	Het
Notch1	A	G	2: 26,472,169	C1025R	probably damaging	Het
Nthl1	G	A	17: 24,634,115	V98M	probably damaging	Het
Olfr1145	A	T	2: 87,810,710	I297F	probably damaging	Het
Olfr1234	T	C	2: 89,363,229	I67V	probably benign	Het
Pank3	A	G	11: 35,776,359	D101G	probably null	Het
Phtf2	T	C	5: 20,802,032	R178G	possibly damaging	Het
Pitrm1	T	C	13: 6,568,786		probably null	Het
Platr25	T	C	13: 62,700,772	Y92C	probably damaging	Het
Plpp1	A	T	13: 112,834,928	D43V	probably damaging	Het
Prg4	G	A	1: 150,454,645	T759I	unknown	Het
Pros1	A	G	16: 62,910,109	T321A	probably benign	Het
Rad50	G	A	11: 53,678,939	Q882*	probably null	Het
Rasa3	A	C	8: 13,581,322	F533V	probably benign	Het
Rgs18	T	A	1: 144,754,027	I165F	probably damaging	Het
Rtl1	C	T	12: 109,593,873	V511I	possibly damaging	Het
Sdc3	A	G	4: 130,818,761	T144A	unknown	Het
Slc9a9	T	C	9: 94,936,365	F271L	probably benign	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Tcerg1	T	A	18: 42,564,122	D759E	probably damaging	Het
Tecta	A	G	9: 42,373,110	L893P	probably damaging	Het
Tex101	T	A	7: 24,668,532	Q167L	possibly damaging	Het
Trmt1l	T	C	1: 151,453,991	S562P	probably damaging	Het
Ubn1	A	G	16: 5,073,399	E546G	probably damaging	Het
Usp38	T	A	8: 80,985,717	Q563L	probably benign	Het
Vmn1r1	C	T	1: 182,157,573	V176I	probably benign	Het
Vmn2r1	A	G	3: 64,086,521	K96R	probably benign	Het
Vmn2r62	A	G	7: 42,764,568	V817A	probably benign	Het
Wdfy3	A	T	5: 101,851,353	C3066S	possibly damaging	Het
Yeats4	T	C	10: 117,215,755	E199G	possibly damaging	Het
Zcchc11	T	A	4: 108,557,357	W44R	possibly damaging	Het

Other mutations in Tnrc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Tnrc6a	APN	7	123170780	missense	probably benign	0.04
IGL00580:Tnrc6a	APN	7	123174278	missense	probably damaging	1.00
IGL01309:Tnrc6a	APN	7	123171494	missense	probably benign	0.04
IGL02004:Tnrc6a	APN	7	123181366	missense	possibly damaging	0.57
IGL02142:Tnrc6a	APN	7	123152191	intron	probably benign
IGL02220:Tnrc6a	APN	7	123170456	missense	probably benign
IGL02436:Tnrc6a	APN	7	123184215	nonsense	probably null
IGL02670:Tnrc6a	APN	7	123171312	missense	possibly damaging	0.92
IGL02743:Tnrc6a	APN	7	123171473	missense	probably damaging	1.00
0152:Tnrc6a	UTSW	7	123180654	missense	probably damaging	1.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0369:Tnrc6a	UTSW	7	123170860	missense	probably damaging	1.00
R0512:Tnrc6a	UTSW	7	123186728	splice site	probably benign
R0566:Tnrc6a	UTSW	7	123170913	missense	probably benign	0.00
R0600:Tnrc6a	UTSW	7	123171816	missense	probably benign	0.14
R0751:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1184:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1319:Tnrc6a	UTSW	7	123184251	missense	probably benign	0.02
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1585:Tnrc6a	UTSW	7	123176875	missense	probably benign	0.08
R1709:Tnrc6a	UTSW	7	123169982	missense	probably benign	0.10
R1776:Tnrc6a	UTSW	7	123171297	missense	probably damaging	1.00
R1791:Tnrc6a	UTSW	7	123192917	missense	possibly damaging	0.47
R1807:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R1876:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2010:Tnrc6a	UTSW	7	123171046	missense	probably benign	0.26
R2086:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2089:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2511:Tnrc6a	UTSW	7	123171092	missense	probably damaging	1.00
R2830:Tnrc6a	UTSW	7	123192949	makesense	probably null
R2850:Tnrc6a	UTSW	7	123179800	missense	probably damaging	1.00
R3916:Tnrc6a	UTSW	7	123181384	missense	probably damaging	1.00
R4028:Tnrc6a	UTSW	7	123170121	missense	probably damaging	1.00
R4235:Tnrc6a	UTSW	7	123171680	missense	probably benign	0.00
R4439:Tnrc6a	UTSW	7	123152182	nonsense	probably null
R4525:Tnrc6a	UTSW	7	123179782	missense	probably benign
R4578:Tnrc6a	UTSW	7	123184221	missense	possibly damaging	0.89
R4613:Tnrc6a	UTSW	7	123184289	critical splice donor site	probably null
R4711:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R4722:Tnrc6a	UTSW	7	123192090	missense	possibly damaging	0.78
R4746:Tnrc6a	UTSW	7	123189997	missense	probably damaging	1.00
R4892:Tnrc6a	UTSW	7	123169911	missense	probably damaging	1.00
R4942:Tnrc6a	UTSW	7	123192613	missense	probably damaging	0.99
R4967:Tnrc6a	UTSW	7	123189872	missense	probably damaging	1.00
R5064:Tnrc6a	UTSW	7	123186723	critical splice donor site	probably null
R5239:Tnrc6a	UTSW	7	123186619	missense	probably benign
R5604:Tnrc6a	UTSW	7	123174236	missense	probably damaging	0.97
R5805:Tnrc6a	UTSW	7	123170076	missense	probably damaging	0.97
R5942:Tnrc6a	UTSW	7	123186665	missense	probably damaging	1.00
R5988:Tnrc6a	UTSW	7	123182380	missense	probably damaging	0.96
R6212:Tnrc6a	UTSW	7	123143742	splice site	probably null
R6284:Tnrc6a	UTSW	7	123171335	missense	probably damaging	0.99
R6417:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6420:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6575:Tnrc6a	UTSW	7	123169910	missense	probably damaging	1.00
R6760:Tnrc6a	UTSW	7	123171999	missense	probably damaging	1.00
R6886:Tnrc6a	UTSW	7	123187445	missense	probably benign	0.17
R6968:Tnrc6a	UTSW	7	123182427	missense	probably benign	0.05
R7216:Tnrc6a	UTSW	7	123171495	missense	probably benign	0.01
R7260:Tnrc6a	UTSW	7	123186590	missense	probably benign	0.36
R7299:Tnrc6a	UTSW	7	123170913	missense	probably benign
R7322:Tnrc6a	UTSW	7	123171508	missense	probably benign	0.09
R7500:Tnrc6a	UTSW	7	123173450	splice site	probably null
R7872:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
R8270:Tnrc6a	UTSW	7	123170071	missense	possibly damaging	0.92
R8313:Tnrc6a	UTSW	7	123170713	missense	possibly damaging	0.92
R8348:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8390:Tnrc6a	UTSW	7	123162571	missense	probably damaging	0.97
R8448:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8552:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R8767:Tnrc6a	UTSW	7	123183910	unclassified	probably benign
R9047:Tnrc6a	UTSW	7	123179723	missense	probably damaging	1.00
R9147:Tnrc6a	UTSW	7	123186444	intron	probably benign
R9153:Tnrc6a	UTSW	7	123174296	missense	probably damaging	1.00
R9166:Tnrc6a	UTSW	7	123187401	missense	probably damaging	1.00
R9179:Tnrc6a	UTSW	7	123192658	missense	probably benign	0.44
R9192:Tnrc6a	UTSW	7	123189953	missense	probably damaging	1.00
R9457:Tnrc6a	UTSW	7	123179735	missense	probably benign	0.24
R9778:Tnrc6a	UTSW	7	123170412	missense	probably benign	0.43
X0064:Tnrc6a	UTSW	7	123169798	missense	probably benign	0.28
Z1176:Tnrc6a	UTSW	7	123162496	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGCATAGCTACAAGCCAGGC -3'
(R):5'- TGTGTCTCTGCAACACAGC -3'

Sequencing Primer
(F):5'- TACAAGCCAGGCCCCTG -3'
(R):5'- CTACTTGGAAGTTTCTGGAAAAGCAG -3'

Posted On

2020-10-20