Incidental Mutation 'R8514:Slc9a9'
ID656039
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8514 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94936365 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 271 (F271L)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably benign
Transcript: ENSMUST00000033463
AA Change: F271L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: F271L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,758,541 V543A probably damaging Het
C330027C09Rik T C 16: 48,997,447 V60A possibly damaging Het
Capn1 T C 19: 5,997,824 E403G probably damaging Het
Casp12 T C 9: 5,352,735 F186L probably damaging Het
Ccdc40 A G 11: 119,230,633 Q13R unknown Het
Ckap2l G T 2: 129,285,868 A130E possibly damaging Het
Creld1 C T 6: 113,492,869 R411C probably damaging Het
Dock9 A T 14: 121,658,787 S167T probably benign Het
Emc10 G T 7: 44,493,222 Q99K probably damaging Het
Fam26f G A 10: 34,126,403 T228I possibly damaging Het
Fryl T A 5: 73,085,356 I1287L probably benign Het
Gjc3 T A 5: 137,957,510 Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,503,320 probably benign Het
Gm597 C T 1: 28,778,505 V149M probably damaging Het
Golga4 T C 9: 118,555,796 V662A possibly damaging Het
Gpr33 A G 12: 52,023,398 V286A probably benign Het
Htr1d A G 4: 136,443,339 E293G probably damaging Het
Ints6 A G 14: 62,695,717 V847A possibly damaging Het
Iqsec3 A G 6: 121,413,562 C317R unknown Het
Mdn1 T A 4: 32,739,857 Y3704N probably damaging Het
Micall2 C A 5: 139,716,222 R422L probably damaging Het
Mndal T C 1: 173,860,192 D492G possibly damaging Het
Myom2 C T 8: 15,125,153 P1244L possibly damaging Het
Notch1 A G 2: 26,472,169 C1025R probably damaging Het
Nthl1 G A 17: 24,634,115 V98M probably damaging Het
Olfr1145 A T 2: 87,810,710 I297F probably damaging Het
Olfr1234 T C 2: 89,363,229 I67V probably benign Het
Pank3 A G 11: 35,776,359 D101G probably null Het
Phtf2 T C 5: 20,802,032 R178G possibly damaging Het
Pitrm1 T C 13: 6,568,786 probably null Het
Platr25 T C 13: 62,700,772 Y92C probably damaging Het
Plpp1 A T 13: 112,834,928 D43V probably damaging Het
Prg4 G A 1: 150,454,645 T759I unknown Het
Pros1 A G 16: 62,910,109 T321A probably benign Het
Rad50 G A 11: 53,678,939 Q882* probably null Het
Rasa3 A C 8: 13,581,322 F533V probably benign Het
Rgs18 T A 1: 144,754,027 I165F probably damaging Het
Rtl1 C T 12: 109,593,873 V511I possibly damaging Het
Sdc3 A G 4: 130,818,761 T144A unknown Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Tcerg1 T A 18: 42,564,122 D759E probably damaging Het
Tecta A G 9: 42,373,110 L893P probably damaging Het
Tex101 T A 7: 24,668,532 Q167L possibly damaging Het
Tnrc6a C T 7: 123,184,215 R970* probably null Het
Trmt1l T C 1: 151,453,991 S562P probably damaging Het
Ubn1 A G 16: 5,073,399 E546G probably damaging Het
Usp38 T A 8: 80,985,717 Q563L probably benign Het
Vmn1r1 C T 1: 182,157,573 V176I probably benign Het
Vmn2r1 A G 3: 64,086,521 K96R probably benign Het
Vmn2r62 A G 7: 42,764,568 V817A probably benign Het
Wdfy3 A T 5: 101,851,353 C3066S possibly damaging Het
Yeats4 T C 10: 117,215,755 E199G possibly damaging Het
Zcchc11 T A 4: 108,557,357 W44R possibly damaging Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATACCATGGGATTGGGGCTG -3'
(R):5'- GGGCTCAGCATGCTGTATTG -3'

Sequencing Primer
(F):5'- CTGGAAGACAAGGAATGCTTACTGC -3'
(R):5'- GCTCAGCATGCTGTATTGAATTGAAG -3'
Posted On2020-10-20