Mutagenetix > Incidental Mutation

Incidental Mutation 'R8514:Golga4'

656040

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8514 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118555796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 662 (V662A)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084820
AA Change: V662A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: V662A

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211840

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212097
AA Change: V634A

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcam	A	G	7: 19,758,541	V543A	probably damaging	Het
C330027C09Rik	T	C	16: 48,997,447	V60A	possibly damaging	Het
Capn1	T	C	19: 5,997,824	E403G	probably damaging	Het
Casp12	T	C	9: 5,352,735	F186L	probably damaging	Het
Ccdc40	A	G	11: 119,230,633	Q13R	unknown	Het
Ckap2l	G	T	2: 129,285,868	A130E	possibly damaging	Het
Creld1	C	T	6: 113,492,869	R411C	probably damaging	Het
Dock9	A	T	14: 121,658,787	S167T	probably benign	Het
Emc10	G	T	7: 44,493,222	Q99K	probably damaging	Het
Fam26f	G	A	10: 34,126,403	T228I	possibly damaging	Het
Fryl	T	A	5: 73,085,356	I1287L	probably benign	Het
Gjc3	T	A	5: 137,957,510	Y171F	probably damaging	Het
Glrp1	GTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTG	1: 88,503,320		probably benign	Het
Gm597	C	T	1: 28,778,505	V149M	probably damaging	Het
Gpr33	A	G	12: 52,023,398	V286A	probably benign	Het
Htr1d	A	G	4: 136,443,339	E293G	probably damaging	Het
Ints6	A	G	14: 62,695,717	V847A	possibly damaging	Het
Iqsec3	A	G	6: 121,413,562	C317R	unknown	Het
Mdn1	T	A	4: 32,739,857	Y3704N	probably damaging	Het
Micall2	C	A	5: 139,716,222	R422L	probably damaging	Het
Mndal	T	C	1: 173,860,192	D492G	possibly damaging	Het
Myom2	C	T	8: 15,125,153	P1244L	possibly damaging	Het
Notch1	A	G	2: 26,472,169	C1025R	probably damaging	Het
Nthl1	G	A	17: 24,634,115	V98M	probably damaging	Het
Olfr1145	A	T	2: 87,810,710	I297F	probably damaging	Het
Olfr1234	T	C	2: 89,363,229	I67V	probably benign	Het
Pank3	A	G	11: 35,776,359	D101G	probably null	Het
Phtf2	T	C	5: 20,802,032	R178G	possibly damaging	Het
Pitrm1	T	C	13: 6,568,786		probably null	Het
Platr25	T	C	13: 62,700,772	Y92C	probably damaging	Het
Plpp1	A	T	13: 112,834,928	D43V	probably damaging	Het
Prg4	G	A	1: 150,454,645	T759I	unknown	Het
Pros1	A	G	16: 62,910,109	T321A	probably benign	Het
Rad50	G	A	11: 53,678,939	Q882*	probably null	Het
Rasa3	A	C	8: 13,581,322	F533V	probably benign	Het
Rgs18	T	A	1: 144,754,027	I165F	probably damaging	Het
Rtl1	C	T	12: 109,593,873	V511I	possibly damaging	Het
Sdc3	A	G	4: 130,818,761	T144A	unknown	Het
Slc9a9	T	C	9: 94,936,365	F271L	probably benign	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Tcerg1	T	A	18: 42,564,122	D759E	probably damaging	Het
Tecta	A	G	9: 42,373,110	L893P	probably damaging	Het
Tex101	T	A	7: 24,668,532	Q167L	possibly damaging	Het
Tnrc6a	C	T	7: 123,184,215	R970*	probably null	Het
Trmt1l	T	C	1: 151,453,991	S562P	probably damaging	Het
Ubn1	A	G	16: 5,073,399	E546G	probably damaging	Het
Usp38	T	A	8: 80,985,717	Q563L	probably benign	Het
Vmn1r1	C	T	1: 182,157,573	V176I	probably benign	Het
Vmn2r1	A	G	3: 64,086,521	K96R	probably benign	Het
Vmn2r62	A	G	7: 42,764,568	V817A	probably benign	Het
Wdfy3	A	T	5: 101,851,353	C3066S	possibly damaging	Het
Yeats4	T	C	10: 117,215,755	E199G	possibly damaging	Het
Zcchc11	T	A	4: 108,557,357	W44R	possibly damaging	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AGGCCCTGCAGTCTTTTATC -3'
(R):5'- GCTCTCAGTGCTTCTGACAG -3'

Sequencing Primer
(F):5'- TCTTGAATTGGAAACCTCTTTGG -3'
(R):5'- AGTGCTTCTGACAGCTCAG -3'

Posted On

2020-10-20