Incidental Mutation 'R8514:Pros1'
ID 656055
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission 067945-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8514 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 62674670-62749709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62730472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 321 (T321A)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably benign
Transcript: ENSMUST00000023629
AA Change: T321A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: T321A

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,492,466 (GRCm39) V543A probably damaging Het
Calhm6 G A 10: 34,002,399 (GRCm39) T228I possibly damaging Het
Capn1 T C 19: 6,047,854 (GRCm39) E403G probably damaging Het
Casp12 T C 9: 5,352,735 (GRCm39) F186L probably damaging Het
Ccdc40 A G 11: 119,121,459 (GRCm39) Q13R unknown Het
Cip2a T C 16: 48,817,810 (GRCm39) V60A possibly damaging Het
Ckap2l G T 2: 129,127,788 (GRCm39) A130E possibly damaging Het
Creld1 C T 6: 113,469,830 (GRCm39) R411C probably damaging Het
Dock9 A T 14: 121,896,199 (GRCm39) S167T probably benign Het
Emc10 G T 7: 44,142,646 (GRCm39) Q99K probably damaging Het
Fryl T A 5: 73,242,699 (GRCm39) I1287L probably benign Het
Gjc3 T A 5: 137,955,772 (GRCm39) Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,431,042 (GRCm39) probably benign Het
Golga4 T C 9: 118,384,864 (GRCm39) V662A possibly damaging Het
Gpr33 A G 12: 52,070,181 (GRCm39) V286A probably benign Het
Htr1d A G 4: 136,170,650 (GRCm39) E293G probably damaging Het
Ints6 A G 14: 62,933,166 (GRCm39) V847A possibly damaging Het
Iqsec3 A G 6: 121,390,521 (GRCm39) C317R unknown Het
Mdn1 T A 4: 32,739,857 (GRCm39) Y3704N probably damaging Het
Micall2 C A 5: 139,701,977 (GRCm39) R422L probably damaging Het
Mndal T C 1: 173,687,758 (GRCm39) D492G possibly damaging Het
Myom2 C T 8: 15,175,153 (GRCm39) P1244L possibly damaging Het
Notch1 A G 2: 26,362,181 (GRCm39) C1025R probably damaging Het
Nthl1 G A 17: 24,853,089 (GRCm39) V98M probably damaging Het
Or12e10 A T 2: 87,641,054 (GRCm39) I297F probably damaging Het
Or4a15 T C 2: 89,193,573 (GRCm39) I67V probably benign Het
Pank3 A G 11: 35,667,186 (GRCm39) D101G probably null Het
Phtf2 T C 5: 21,007,030 (GRCm39) R178G possibly damaging Het
Pitrm1 T C 13: 6,618,822 (GRCm39) probably null Het
Platr25 T C 13: 62,848,586 (GRCm39) Y92C probably damaging Het
Plpp1 A T 13: 112,971,462 (GRCm39) D43V probably damaging Het
Prg4 G A 1: 150,330,396 (GRCm39) T759I unknown Het
Rad50 G A 11: 53,569,766 (GRCm39) Q882* probably null Het
Rasa3 A C 8: 13,631,322 (GRCm39) F533V probably benign Het
Rgs18 T A 1: 144,629,765 (GRCm39) I165F probably damaging Het
Rtl1 C T 12: 109,560,307 (GRCm39) V511I possibly damaging Het
Sdc3 A G 4: 130,546,072 (GRCm39) T144A unknown Het
Slc9a9 T C 9: 94,818,418 (GRCm39) F271L probably benign Het
Snrpa1 G A 7: 65,720,381 (GRCm39) G195R probably benign Het
Spata31e5 C T 1: 28,817,586 (GRCm39) V149M probably damaging Het
Tcerg1 T A 18: 42,697,187 (GRCm39) D759E probably damaging Het
Tecta A G 9: 42,284,406 (GRCm39) L893P probably damaging Het
Tex101 T A 7: 24,367,957 (GRCm39) Q167L possibly damaging Het
Tnrc6a C T 7: 122,783,438 (GRCm39) R970* probably null Het
Trmt1l T C 1: 151,329,742 (GRCm39) S562P probably damaging Het
Tut4 T A 4: 108,414,554 (GRCm39) W44R possibly damaging Het
Ubn1 A G 16: 4,891,263 (GRCm39) E546G probably damaging Het
Usp38 T A 8: 81,712,346 (GRCm39) Q563L probably benign Het
Vmn1r1 C T 1: 181,985,138 (GRCm39) V176I probably benign Het
Vmn2r1 A G 3: 63,993,942 (GRCm39) K96R probably benign Het
Vmn2r62 A G 7: 42,413,992 (GRCm39) V817A probably benign Het
Wdfy3 A T 5: 101,999,219 (GRCm39) C3066S possibly damaging Het
Yeats4 T C 10: 117,051,660 (GRCm39) E199G possibly damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62,730,408 (GRCm39) missense probably damaging 0.99
IGL01300:Pros1 APN 16 62,734,174 (GRCm39) missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62,719,308 (GRCm39) missense probably damaging 0.99
IGL03080:Pros1 APN 16 62,738,506 (GRCm39) missense probably damaging 0.98
IGL03095:Pros1 APN 16 62,728,132 (GRCm39) nonsense probably null
F6893:Pros1 UTSW 16 62,745,002 (GRCm39) missense probably damaging 0.98
R0124:Pros1 UTSW 16 62,734,309 (GRCm39) missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably benign 0.03
R1113:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1308:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1355:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1370:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1517:Pros1 UTSW 16 62,705,875 (GRCm39) missense probably damaging 0.98
R1866:Pros1 UTSW 16 62,748,498 (GRCm39) missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably damaging 0.96
R2255:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62,734,211 (GRCm39) missense probably damaging 0.99
R2369:Pros1 UTSW 16 62,748,432 (GRCm39) missense probably damaging 1.00
R2979:Pros1 UTSW 16 62,734,229 (GRCm39) missense probably damaging 0.99
R3724:Pros1 UTSW 16 62,720,692 (GRCm39) missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62,721,008 (GRCm39) nonsense probably null
R4556:Pros1 UTSW 16 62,721,036 (GRCm39) missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62,709,370 (GRCm39) critical splice donor site probably null
R4850:Pros1 UTSW 16 62,705,887 (GRCm39) missense probably damaging 0.98
R4923:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62,748,548 (GRCm39) missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62,734,339 (GRCm39) missense probably benign 0.01
R5580:Pros1 UTSW 16 62,746,689 (GRCm39) critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62,748,424 (GRCm39) missense probably damaging 0.96
R5974:Pros1 UTSW 16 62,721,030 (GRCm39) missense probably damaging 0.98
R6233:Pros1 UTSW 16 62,719,284 (GRCm39) missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62,744,938 (GRCm39) missense probably benign 0.01
R7055:Pros1 UTSW 16 62,748,465 (GRCm39) missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62,739,886 (GRCm39) missense probably damaging 0.97
R7375:Pros1 UTSW 16 62,744,913 (GRCm39) missense probably damaging 0.96
R7419:Pros1 UTSW 16 62,748,433 (GRCm39) nonsense probably null
R7980:Pros1 UTSW 16 62,748,516 (GRCm39) missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62,748,540 (GRCm39) missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62,728,102 (GRCm39) missense probably damaging 1.00
R8827:Pros1 UTSW 16 62,746,827 (GRCm39) missense probably benign 0.13
R9131:Pros1 UTSW 16 62,748,397 (GRCm39) missense probably damaging 0.96
R9484:Pros1 UTSW 16 62,744,887 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTTCAGAGGCTGTTTTGAGAAC -3'
(R):5'- ATTTCACAAGTGGGTTAGGTCC -3'

Sequencing Primer
(F):5'- TCAGAGGCTGTTTTGAGAACTAAAG -3'
(R):5'- GGTTAGGTCCCCACTCTCAG -3'
Posted On 2020-10-20