Mutagenetix > Incidental Mutation

Incidental Mutation 'R8514:Pros1'

656055

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8514 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62910109 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 321 (T321A)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably benign
Transcript: ENSMUST00000023629
AA Change: T321A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: T321A

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcam	A	G	7: 19,758,541	V543A	probably damaging	Het
C330027C09Rik	T	C	16: 48,997,447	V60A	possibly damaging	Het
Capn1	T	C	19: 5,997,824	E403G	probably damaging	Het
Casp12	T	C	9: 5,352,735	F186L	probably damaging	Het
Ccdc40	A	G	11: 119,230,633	Q13R	unknown	Het
Ckap2l	G	T	2: 129,285,868	A130E	possibly damaging	Het
Creld1	C	T	6: 113,492,869	R411C	probably damaging	Het
Dock9	A	T	14: 121,658,787	S167T	probably benign	Het
Emc10	G	T	7: 44,493,222	Q99K	probably damaging	Het
Fam26f	G	A	10: 34,126,403	T228I	possibly damaging	Het
Fryl	T	A	5: 73,085,356	I1287L	probably benign	Het
Gjc3	T	A	5: 137,957,510	Y171F	probably damaging	Het
Glrp1	GTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTG	1: 88,503,320		probably benign	Het
Gm597	C	T	1: 28,778,505	V149M	probably damaging	Het
Golga4	T	C	9: 118,555,796	V662A	possibly damaging	Het
Gpr33	A	G	12: 52,023,398	V286A	probably benign	Het
Htr1d	A	G	4: 136,443,339	E293G	probably damaging	Het
Ints6	A	G	14: 62,695,717	V847A	possibly damaging	Het
Iqsec3	A	G	6: 121,413,562	C317R	unknown	Het
Mdn1	T	A	4: 32,739,857	Y3704N	probably damaging	Het
Micall2	C	A	5: 139,716,222	R422L	probably damaging	Het
Mndal	T	C	1: 173,860,192	D492G	possibly damaging	Het
Myom2	C	T	8: 15,125,153	P1244L	possibly damaging	Het
Notch1	A	G	2: 26,472,169	C1025R	probably damaging	Het
Nthl1	G	A	17: 24,634,115	V98M	probably damaging	Het
Olfr1145	A	T	2: 87,810,710	I297F	probably damaging	Het
Olfr1234	T	C	2: 89,363,229	I67V	probably benign	Het
Pank3	A	G	11: 35,776,359	D101G	probably null	Het
Phtf2	T	C	5: 20,802,032	R178G	possibly damaging	Het
Pitrm1	T	C	13: 6,568,786		probably null	Het
Platr25	T	C	13: 62,700,772	Y92C	probably damaging	Het
Plpp1	A	T	13: 112,834,928	D43V	probably damaging	Het
Prg4	G	A	1: 150,454,645	T759I	unknown	Het
Rad50	G	A	11: 53,678,939	Q882*	probably null	Het
Rasa3	A	C	8: 13,581,322	F533V	probably benign	Het
Rgs18	T	A	1: 144,754,027	I165F	probably damaging	Het
Rtl1	C	T	12: 109,593,873	V511I	possibly damaging	Het
Sdc3	A	G	4: 130,818,761	T144A	unknown	Het
Slc9a9	T	C	9: 94,936,365	F271L	probably benign	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Tcerg1	T	A	18: 42,564,122	D759E	probably damaging	Het
Tecta	A	G	9: 42,373,110	L893P	probably damaging	Het
Tex101	T	A	7: 24,668,532	Q167L	possibly damaging	Het
Tnrc6a	C	T	7: 123,184,215	R970*	probably null	Het
Trmt1l	T	C	1: 151,453,991	S562P	probably damaging	Het
Ubn1	A	G	16: 5,073,399	E546G	probably damaging	Het
Usp38	T	A	8: 80,985,717	Q563L	probably benign	Het
Vmn1r1	C	T	1: 182,157,573	V176I	probably benign	Het
Vmn2r1	A	G	3: 64,086,521	K96R	probably benign	Het
Vmn2r62	A	G	7: 42,764,568	V817A	probably benign	Het
Wdfy3	A	T	5: 101,851,353	C3066S	possibly damaging	Het
Yeats4	T	C	10: 117,215,755	E199G	possibly damaging	Het
Zcchc11	T	A	4: 108,557,357	W44R	possibly damaging	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTTCAGAGGCTGTTTTGAGAAC -3'
(R):5'- ATTTCACAAGTGGGTTAGGTCC -3'

Sequencing Primer
(F):5'- TCAGAGGCTGTTTTGAGAACTAAAG -3'
(R):5'- GGTTAGGTCCCCACTCTCAG -3'

Posted On

2020-10-20