Incidental Mutation 'R8514:Capn1'
ID656058
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Namecalpain 1
Synonymsmu-calpin, Capa1, Capa-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8514 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5988546-6015825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5997824 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 403 (E403G)
Ref Sequence ENSEMBL: ENSMUSP00000025891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
Predicted Effect probably damaging
Transcript: ENSMUST00000025891
AA Change: E403G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: E403G

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164843
AA Change: E403G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: E403G

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcam A G 7: 19,758,541 V543A probably damaging Het
C330027C09Rik T C 16: 48,997,447 V60A possibly damaging Het
Casp12 T C 9: 5,352,735 F186L probably damaging Het
Ccdc40 A G 11: 119,230,633 Q13R unknown Het
Ckap2l G T 2: 129,285,868 A130E possibly damaging Het
Creld1 C T 6: 113,492,869 R411C probably damaging Het
Dock9 A T 14: 121,658,787 S167T probably benign Het
Emc10 G T 7: 44,493,222 Q99K probably damaging Het
Fam26f G A 10: 34,126,403 T228I possibly damaging Het
Fryl T A 5: 73,085,356 I1287L probably benign Het
Gjc3 T A 5: 137,957,510 Y171F probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTG 1: 88,503,320 probably benign Het
Gm597 C T 1: 28,778,505 V149M probably damaging Het
Golga4 T C 9: 118,555,796 V662A possibly damaging Het
Gpr33 A G 12: 52,023,398 V286A probably benign Het
Htr1d A G 4: 136,443,339 E293G probably damaging Het
Ints6 A G 14: 62,695,717 V847A possibly damaging Het
Iqsec3 A G 6: 121,413,562 C317R unknown Het
Mdn1 T A 4: 32,739,857 Y3704N probably damaging Het
Micall2 C A 5: 139,716,222 R422L probably damaging Het
Mndal T C 1: 173,860,192 D492G possibly damaging Het
Myom2 C T 8: 15,125,153 P1244L possibly damaging Het
Notch1 A G 2: 26,472,169 C1025R probably damaging Het
Nthl1 G A 17: 24,634,115 V98M probably damaging Het
Olfr1145 A T 2: 87,810,710 I297F probably damaging Het
Olfr1234 T C 2: 89,363,229 I67V probably benign Het
Pank3 A G 11: 35,776,359 D101G probably null Het
Phtf2 T C 5: 20,802,032 R178G possibly damaging Het
Pitrm1 T C 13: 6,568,786 probably null Het
Platr25 T C 13: 62,700,772 Y92C probably damaging Het
Plpp1 A T 13: 112,834,928 D43V probably damaging Het
Prg4 G A 1: 150,454,645 T759I unknown Het
Pros1 A G 16: 62,910,109 T321A probably benign Het
Rad50 G A 11: 53,678,939 Q882* probably null Het
Rasa3 A C 8: 13,581,322 F533V probably benign Het
Rgs18 T A 1: 144,754,027 I165F probably damaging Het
Rtl1 C T 12: 109,593,873 V511I possibly damaging Het
Sdc3 A G 4: 130,818,761 T144A unknown Het
Slc9a9 T C 9: 94,936,365 F271L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Tcerg1 T A 18: 42,564,122 D759E probably damaging Het
Tecta A G 9: 42,373,110 L893P probably damaging Het
Tex101 T A 7: 24,668,532 Q167L possibly damaging Het
Tnrc6a C T 7: 123,184,215 R970* probably null Het
Trmt1l T C 1: 151,453,991 S562P probably damaging Het
Ubn1 A G 16: 5,073,399 E546G probably damaging Het
Usp38 T A 8: 80,985,717 Q563L probably benign Het
Vmn1r1 C T 1: 182,157,573 V176I probably benign Het
Vmn2r1 A G 3: 64,086,521 K96R probably benign Het
Vmn2r62 A G 7: 42,764,568 V817A probably benign Het
Wdfy3 A T 5: 101,851,353 C3066S possibly damaging Het
Yeats4 T C 10: 117,215,755 E199G possibly damaging Het
Zcchc11 T A 4: 108,557,357 W44R possibly damaging Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6007269 missense probably damaging 1.00
IGL01314:Capn1 APN 19 5989984 splice site probably benign
R0044:Capn1 UTSW 19 6014343 missense probably benign 0.03
R1496:Capn1 UTSW 19 6007498 critical splice donor site probably null
R1646:Capn1 UTSW 19 5997730 missense probably benign
R1852:Capn1 UTSW 19 6009103 missense possibly damaging 0.95
R1924:Capn1 UTSW 19 5990056 splice site probably null
R2006:Capn1 UTSW 19 5991583 missense probably damaging 1.00
R2109:Capn1 UTSW 19 6014358 missense probably benign 0.01
R3704:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3705:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3830:Capn1 UTSW 19 5994847 missense probably damaging 1.00
R4664:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4665:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4666:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4694:Capn1 UTSW 19 5994731 nonsense probably null
R4745:Capn1 UTSW 19 5993916 missense probably benign 0.12
R5103:Capn1 UTSW 19 6009110 missense probably damaging 1.00
R5149:Capn1 UTSW 19 5990334 splice site probably null
R5569:Capn1 UTSW 19 6013660 missense probably benign
R5636:Capn1 UTSW 19 6014442 missense probably benign 0.22
R5906:Capn1 UTSW 19 6011421 missense possibly damaging 0.90
R5907:Capn1 UTSW 19 5997797 missense probably benign
R7038:Capn1 UTSW 19 6014319 missense probably benign 0.23
R7091:Capn1 UTSW 19 5991556 missense possibly damaging 0.64
R7307:Capn1 UTSW 19 5993908 missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6014439 missense probably benign 0.00
R7779:Capn1 UTSW 19 5994086 missense probably benign
R8708:Capn1 UTSW 19 6011298 missense probably damaging 1.00
Z1176:Capn1 UTSW 19 6014278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAGGAGCTCCTTCCTGCAC -3'
(R):5'- TACTGCCCCTTCTGGAAGAG -3'

Sequencing Primer
(F):5'- TTTCAGGCCCTCAGGATGCAC -3'
(R):5'- AAGAGGCGTCTCGTCCATCTG -3'
Posted On2020-10-20