Incidental Mutation 'R0371:Irf2bpl'
ID 65607
Institutional Source Beutler Lab
Gene Symbol Irf2bpl
Ensembl Gene ENSMUSG00000034168
Gene Name interferon regulatory factor 2 binding protein-like
Synonyms 6430527G18Rik
MMRRC Submission 038577-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R0371 (G1)
Quality Score 160
Status Validated
Chromosome 12
Chromosomal Location 86927475-86931572 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 86928417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 752 (W752*)
Ref Sequence ENSEMBL: ENSMUSP00000041070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038422]
AlphaFold Q8K3X4
Predicted Effect probably null
Transcript: ENSMUST00000038422
AA Change: W752*
SMART Domains Protein: ENSMUSP00000041070
Gene: ENSMUSG00000034168
AA Change: W752*

DomainStartEndE-ValueType
Pfam:IRF-2BP1_2 10 61 2e-38 PFAM
low complexity region 70 78 N/A INTRINSIC
coiled coil region 84 113 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 258 300 N/A INTRINSIC
coiled coil region 314 350 N/A INTRINSIC
low complexity region 496 519 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 627 646 N/A INTRINSIC
PDB:2CS3|A 684 765 7e-52 PDB
SCOP:d1fbva4 692 738 4e-6 SMART
Blast:RING 694 745 4e-24 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that may play a role in regulating female reproductive function. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,105,911 (GRCm39) R1068C probably benign Het
Afmid C T 11: 117,725,966 (GRCm39) probably benign Het
Aqr A G 2: 113,988,085 (GRCm39) V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 (GRCm39) T288R possibly damaging Het
Btnl1 T C 17: 34,600,031 (GRCm39) V178A probably damaging Het
Ccdc110 T A 8: 46,395,843 (GRCm39) M578K possibly damaging Het
Ccdc38 G T 10: 93,398,674 (GRCm39) E51* probably null Het
Cep290 T A 10: 100,354,426 (GRCm39) probably benign Het
Cilp2 T C 8: 70,334,256 (GRCm39) E914G probably damaging Het
Col6a2 T C 10: 76,450,307 (GRCm39) N208S probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp4a12a C G 4: 115,183,880 (GRCm39) R229G probably damaging Het
Dach1 C T 14: 98,207,339 (GRCm39) V337M probably damaging Het
Dcbld2 A G 16: 58,271,186 (GRCm39) N321S probably benign Het
Enpep C T 3: 129,077,516 (GRCm39) probably null Het
Fat1 T C 8: 45,404,929 (GRCm39) L560P probably damaging Het
Fdxr T C 11: 115,166,915 (GRCm39) H58R possibly damaging Het
Filip1 G T 9: 79,767,373 (GRCm39) P147T probably damaging Het
Fras1 G A 5: 96,703,190 (GRCm39) E318K possibly damaging Het
Grk2 T C 19: 4,341,614 (GRCm39) probably null Het
Gvin-ps6 A T 7: 106,021,986 (GRCm39) C339S unknown Het
Havcr1 T C 11: 46,643,416 (GRCm39) I112T possibly damaging Het
Hjurp G A 1: 88,205,090 (GRCm39) probably benign Het
Ildr2 G A 1: 166,131,133 (GRCm39) V330I probably damaging Het
Ino80d T C 1: 63,097,115 (GRCm39) probably benign Het
Iqsec1 A G 6: 90,647,385 (GRCm39) probably benign Het
Kdr T A 5: 76,102,494 (GRCm39) H1211L probably benign Het
Klri2 A G 6: 129,709,106 (GRCm39) *249R probably null Het
Ktn1 A T 14: 47,961,460 (GRCm39) K1054* probably null Het
Lactb2 A G 1: 13,720,984 (GRCm39) S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 (GRCm38) C15* probably null Het
Mrs2 T C 13: 25,177,078 (GRCm39) I430V probably benign Het
Myo3b C T 2: 70,083,304 (GRCm39) probably benign Het
Nbas C T 12: 13,381,096 (GRCm39) T696I probably damaging Het
Nsun6 T C 2: 15,034,898 (GRCm39) D240G probably damaging Het
Nup107 T C 10: 117,599,674 (GRCm39) E615G probably damaging Het
Or2a25 A T 6: 42,888,872 (GRCm39) R138S probably benign Het
Or3a1d T A 11: 74,237,760 (GRCm39) I217F probably damaging Het
Or4k77 A T 2: 111,199,498 (GRCm39) I174L probably benign Het
Or5ac23 A G 16: 59,149,585 (GRCm39) C96R possibly damaging Het
Pabpc1l G A 2: 163,877,192 (GRCm39) V256M probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sik1 T C 17: 32,067,958 (GRCm39) D409G probably benign Het
Slc22a22 A T 15: 57,113,131 (GRCm39) D369E possibly damaging Het
Smg1 T A 7: 117,767,523 (GRCm39) probably benign Het
Snap29 C A 16: 17,224,067 (GRCm39) D27E probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Sorcs3 A G 19: 48,592,333 (GRCm39) I333V probably benign Het
Spag7 A G 11: 70,555,622 (GRCm39) M105T probably damaging Het
Srgap3 A T 6: 112,748,432 (GRCm39) S407T probably damaging Het
Supt6 T C 11: 78,113,983 (GRCm39) N854S probably benign Het
Syne2 T C 12: 75,980,619 (GRCm39) S1460P probably damaging Het
Taok3 C T 5: 117,344,752 (GRCm39) Q160* probably null Het
Tchhl1 C A 3: 93,376,884 (GRCm39) A27E probably damaging Het
Tet1 T C 10: 62,714,178 (GRCm39) D539G probably damaging Het
Tut1 T C 19: 8,940,137 (GRCm39) F374L probably damaging Het
Unc5c C T 3: 141,533,283 (GRCm39) P770S probably benign Het
Vmn2r101 T A 17: 19,810,394 (GRCm39) N393K probably benign Het
Vmn2r94 T A 17: 18,477,556 (GRCm39) H285L probably benign Het
Wdr62 G A 7: 29,941,583 (GRCm39) S700L possibly damaging Het
Wscd1 A G 11: 71,679,549 (GRCm39) D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 (GRCm39) N106S probably damaging Het
Zfp345 G T 2: 150,313,983 (GRCm39) T518N possibly damaging Het
Zfp648 A T 1: 154,080,413 (GRCm39) S191C possibly damaging Het
Zkscan8 C T 13: 21,710,844 (GRCm39) E89K probably damaging Het
Other mutations in Irf2bpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03343:Irf2bpl APN 12 86,929,713 (GRCm39) missense possibly damaging 0.72
twig UTSW 12 86,930,238 (GRCm39) missense probably benign 0.01
PIT1430001:Irf2bpl UTSW 12 86,930,229 (GRCm39) missense possibly damaging 0.91
R0218:Irf2bpl UTSW 12 86,929,398 (GRCm39) missense probably benign 0.02
R0426:Irf2bpl UTSW 12 86,929,870 (GRCm39) missense probably benign 0.06
R1351:Irf2bpl UTSW 12 86,929,398 (GRCm39) missense probably benign 0.02
R2881:Irf2bpl UTSW 12 86,929,551 (GRCm39) missense probably damaging 0.98
R3610:Irf2bpl UTSW 12 86,928,631 (GRCm39) missense probably benign 0.03
R4206:Irf2bpl UTSW 12 86,929,810 (GRCm39) missense probably benign 0.00
R4240:Irf2bpl UTSW 12 86,929,691 (GRCm39) missense possibly damaging 0.73
R4938:Irf2bpl UTSW 12 86,928,892 (GRCm39) missense possibly damaging 0.73
R5451:Irf2bpl UTSW 12 86,928,846 (GRCm39) missense probably benign 0.33
R6213:Irf2bpl UTSW 12 86,930,367 (GRCm39) missense probably benign 0.18
R6491:Irf2bpl UTSW 12 86,930,238 (GRCm39) missense probably benign 0.01
R6969:Irf2bpl UTSW 12 86,929,468 (GRCm39) missense possibly damaging 0.86
R7151:Irf2bpl UTSW 12 86,930,127 (GRCm39) missense probably benign 0.00
R7649:Irf2bpl UTSW 12 86,929,572 (GRCm39) missense possibly damaging 0.96
R7751:Irf2bpl UTSW 12 86,930,489 (GRCm39) missense probably damaging 0.99
R8711:Irf2bpl UTSW 12 86,928,496 (GRCm39) missense probably benign 0.03
R8857:Irf2bpl UTSW 12 86,929,359 (GRCm39) missense possibly damaging 0.96
X0066:Irf2bpl UTSW 12 86,928,424 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACCAGCAGCAGTCGTTGCTAAG -3'
(R):5'- TGGAGGACACGCATTTCGTTCAG -3'

Sequencing Primer
(F):5'- CAGTCGTTGCTAAGGGCTATTAATTC -3'
(R):5'- GCATTTCGTTCAGTGTCCG -3'
Posted On 2013-08-08