Incidental Mutation 'R8515:Man2a2'
ID 656083
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R8515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 80349097-80371375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80368290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 211 (F211I)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000205436] [ENSMUST00000206212] [ENSMUST00000206301]
AlphaFold Q8BRK9
Predicted Effect possibly damaging
Transcript: ENSMUST00000098346
AA Change: F211I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: F211I

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205436
Predicted Effect probably benign
Transcript: ENSMUST00000205853
Predicted Effect probably benign
Transcript: ENSMUST00000206212
Predicted Effect probably damaging
Transcript: ENSMUST00000206301
AA Change: F211I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,288,602 D2858V probably benign Het
Aak1 A G 6: 86,925,130 M94V possibly damaging Het
Acss3 A G 10: 106,948,663 I566T possibly damaging Het
Adcy3 T C 12: 4,212,187 V1080A probably damaging Het
Aldh1b1 C T 4: 45,803,818 T452I probably damaging Het
Bptf A T 11: 107,055,238 S2392T possibly damaging Het
Ccnb2 A G 9: 70,413,100 probably null Het
Clec4a4 T A 6: 123,004,023 Y72N probably benign Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Ctbs T A 3: 146,458,813 Y240* probably null Het
Cyp2d22 T C 15: 82,373,912 D169G probably benign Het
Dnah11 C T 12: 117,975,798 V3196I probably damaging Het
Fam110b T C 4: 5,799,380 V266A probably benign Het
Fbxo40 A G 16: 36,970,653 S32P probably damaging Het
Gm4787 T A 12: 81,377,269 H705L probably benign Het
Grik1 A T 16: 87,923,282 Y702* probably null Het
Hao2 A T 3: 98,883,647 N70K probably benign Het
Heatr4 A G 12: 83,954,704 I888T probably damaging Het
Herc4 T A 10: 63,315,786 N935K probably benign Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kif3b C T 2: 153,316,507 T76M probably damaging Het
Kmo A T 1: 175,647,152 H134L probably damaging Het
Lama3 C A 18: 12,411,631 Q344K probably null Het
Mmp19 T C 10: 128,795,602 I189T probably benign Het
Muc4 G A 16: 32,755,255 G1710S unknown Het
Myo15b G A 11: 115,858,784 G127S Het
Naca T C 10: 128,044,243 S1715P possibly damaging Het
Ndufs4 T C 13: 114,288,803 N163S probably damaging Het
Nim1k G A 13: 119,712,450 R303* probably null Het
Nkx6-3 A T 8: 23,153,691 Y36F possibly damaging Het
Osbpl10 C A 9: 115,176,068 Q188K probably benign Het
Pak6 G T 2: 118,689,997 R156S probably benign Het
Pcf11 T A 7: 92,658,790 K723N possibly damaging Het
Pcnx A G 12: 81,962,716 Y546C possibly damaging Het
Pik3r6 A G 11: 68,539,957 Y528C probably damaging Het
Ppp3cb T A 14: 20,531,776 N57I probably benign Het
Preb A G 5: 30,959,378 L57P probably damaging Het
Prkdc A G 16: 15,664,368 D425G probably damaging Het
Rab35 G A 5: 115,643,408 V90I probably damaging Het
Rab3gap2 G C 1: 185,262,820 S852T probably benign Het
Rcn1 C T 2: 105,389,119 R243Q probably null Het
Rom1 A G 19: 8,929,101 S25P probably damaging Het
Shank3 C A 15: 89,503,572 Y286* probably null Het
Sis T A 3: 72,929,409 I837L probably benign Het
Ski T C 4: 155,160,626 S388G possibly damaging Het
Skint1 T C 4: 112,010,724 F16S probably benign Het
Slc22a21 T G 11: 53,956,078 D323A possibly damaging Het
Slc40a1 G A 1: 45,912,307 T230I probably damaging Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Spdl1 G A 11: 34,813,425 T527I possibly damaging Het
Sptb A T 12: 76,612,041 L1240Q probably benign Het
Tef T A 15: 81,802,836 V18D possibly damaging Het
Uckl1 T C 2: 181,574,487 D155G probably damaging Het
Vmn1r215 A G 13: 23,075,867 I26V probably benign Het
Wac A G 18: 7,871,606 M46V probably benign Het
Wbp1 C T 6: 83,119,885 G146D probably damaging Het
Zfand2a A C 5: 139,473,791 S147A probably benign Het
Zfhx4 A T 3: 5,399,474 Y1589F probably benign Het
Zfp345 G C 2: 150,472,428 D396E probably benign Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8842:Man2a2 UTSW 7 80353319 missense probably damaging 1.00
R9205:Man2a2 UTSW 7 80361120 missense probably benign
R9563:Man2a2 UTSW 7 80356353 missense probably benign
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCTGCACACTAACAGACC -3'
(R):5'- TTCAGATGGCAGGCATGAGG -3'

Sequencing Primer
(F):5'- TTCTCTGCACACTAACAGACCTTCAG -3'
(R):5'- CATGAGGAGGGTGTGACTG -3'
Posted On 2020-10-20