Incidental Mutation 'R8515:Gm4787'
ID656101
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8515 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81377269 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 705 (H705L)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: H705L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: H705L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,288,602 D2858V probably benign Het
Aak1 A G 6: 86,925,130 M94V possibly damaging Het
Acss3 A G 10: 106,948,663 I566T possibly damaging Het
Adcy3 T C 12: 4,212,187 V1080A probably damaging Het
Aldh1b1 C T 4: 45,803,818 T452I probably damaging Het
Bptf A T 11: 107,055,238 S2392T possibly damaging Het
Ccnb2 A G 9: 70,413,100 probably null Het
Clec4a4 T A 6: 123,004,023 Y72N probably benign Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Ctbs T A 3: 146,458,813 Y240* probably null Het
Cyp2d22 T C 15: 82,373,912 D169G probably benign Het
Dnah11 C T 12: 117,975,798 V3196I probably damaging Het
Fam110b T C 4: 5,799,380 V266A probably benign Het
Fbxo40 A G 16: 36,970,653 S32P probably damaging Het
Grik1 A T 16: 87,923,282 Y702* probably null Het
Hao2 A T 3: 98,883,647 N70K probably benign Het
Heatr4 A G 12: 83,954,704 I888T probably damaging Het
Herc4 T A 10: 63,315,786 N935K probably benign Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kif3b C T 2: 153,316,507 T76M probably damaging Het
Kmo A T 1: 175,647,152 H134L probably damaging Het
Lama3 C A 18: 12,411,631 Q344K probably null Het
Man2a2 A T 7: 80,368,290 F211I possibly damaging Het
Mmp19 T C 10: 128,795,602 I189T probably benign Het
Muc4 G A 16: 32,755,255 G1710S unknown Het
Myo15b G A 11: 115,858,784 G127S Het
Naca T C 10: 128,044,243 S1715P possibly damaging Het
Ndufs4 T C 13: 114,288,803 N163S probably damaging Het
Nim1k G A 13: 119,712,450 R303* probably null Het
Nkx6-3 A T 8: 23,153,691 Y36F possibly damaging Het
Osbpl10 C A 9: 115,176,068 Q188K probably benign Het
Pak6 G T 2: 118,689,997 R156S probably benign Het
Pcf11 T A 7: 92,658,790 K723N possibly damaging Het
Pcnx A G 12: 81,962,716 Y546C possibly damaging Het
Pik3r6 A G 11: 68,539,957 Y528C probably damaging Het
Ppp3cb T A 14: 20,531,776 N57I probably benign Het
Preb A G 5: 30,959,378 L57P probably damaging Het
Prkdc A G 16: 15,664,368 D425G probably damaging Het
Rab35 G A 5: 115,643,408 V90I probably damaging Het
Rab3gap2 G C 1: 185,262,820 S852T probably benign Het
Rcn1 C T 2: 105,389,119 R243Q probably null Het
Rom1 A G 19: 8,929,101 S25P probably damaging Het
Shank3 C A 15: 89,503,572 Y286* probably null Het
Sis T A 3: 72,929,409 I837L probably benign Het
Ski T C 4: 155,160,626 S388G possibly damaging Het
Skint1 T C 4: 112,010,724 F16S probably benign Het
Slc22a21 T G 11: 53,956,078 D323A possibly damaging Het
Slc40a1 G A 1: 45,912,307 T230I probably damaging Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Spdl1 G A 11: 34,813,425 T527I possibly damaging Het
Sptb A T 12: 76,612,041 L1240Q probably benign Het
Tef T A 15: 81,802,836 V18D possibly damaging Het
Uckl1 T C 2: 181,574,487 D155G probably damaging Het
Vmn1r215 A G 13: 23,075,867 I26V probably benign Het
Wac A G 18: 7,871,606 M46V probably benign Het
Wbp1 C T 6: 83,119,885 G146D probably damaging Het
Zfand2a A C 5: 139,473,791 S147A probably benign Het
Zfhx4 A T 3: 5,399,474 Y1589F probably benign Het
Zfp345 G C 2: 150,472,428 D396E probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81377905 missense probably benign 0.01
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81378151 missense probably benign 0.00
R8314:Gm4787 UTSW 12 81379135 missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81377506 missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTGTGTGGCTCCAATTAG -3'
(R):5'- ACTTGTGGCCCTGGAAAATACTG -3'

Sequencing Primer
(F):5'- GGCTCCAATTAGTTTAGGATGAAGTC -3'
(R):5'- GGCCCTGGAAAATACTGTAAAAATC -3'
Posted On2020-10-20