Mutagenetix > Incidental Mutations

Incidental Mutation 'R8515:Gm4787'

656101

Institutional Source

Beutler Lab

Gene Symbol

Gm4787

Ensembl Gene

ENSMUSG00000072974

Gene Name

predicted gene 4787

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R8515 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81376991-81379464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81377269 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 705 (H705L)

Ref Sequence

ENSEMBL: ENSMUSP00000077390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]

Predicted Effect

probably benign
Transcript: ENSMUST00000062182
AA Change: H705L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: H705L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	46	163	1.5e-19	PFAM
Pfam:Reprolysin	213	406	4.6e-18	PFAM
DISIN	425	500	2e-33	SMART
ACR	501	644	2.83e-53	SMART
transmembrane domain	714	736	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110340

SMART Domains

Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	74	6.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164386

SMART Domains

Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

Domain	Start	End	E-Value	Type
PDZ	21	100	6.16e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166723

SMART Domains

Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	73	6.9e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,288,602	D2858V	probably benign	Het
Aak1	A	G	6: 86,925,130	M94V	possibly damaging	Het
Acss3	A	G	10: 106,948,663	I566T	possibly damaging	Het
Adcy3	T	C	12: 4,212,187	V1080A	probably damaging	Het
Aldh1b1	C	T	4: 45,803,818	T452I	probably damaging	Het
Bptf	A	T	11: 107,055,238	S2392T	possibly damaging	Het
Ccnb2	A	G	9: 70,413,100		probably null	Het
Clec4a4	T	A	6: 123,004,023	Y72N	probably benign	Het
Clk4	G	A	11: 51,275,261	R198Q	probably damaging	Het
Coro2a	ACCAGAAGAGCCATCCAG	ACCAG	4: 46,544,117		probably null	Het
Ctbs	T	A	3: 146,458,813	Y240*	probably null	Het
Cyp2d22	T	C	15: 82,373,912	D169G	probably benign	Het
Dnah11	C	T	12: 117,975,798	V3196I	probably damaging	Het
Fam110b	T	C	4: 5,799,380	V266A	probably benign	Het
Fbxo40	A	G	16: 36,970,653	S32P	probably damaging	Het
Grik1	A	T	16: 87,923,282	Y702*	probably null	Het
Hao2	A	T	3: 98,883,647	N70K	probably benign	Het
Heatr4	A	G	12: 83,954,704	I888T	probably damaging	Het
Herc4	T	A	10: 63,315,786	N935K	probably benign	Het
Kdm3b	G	T	18: 34,793,076	A90S	probably benign	Het
Kif3b	C	T	2: 153,316,507	T76M	probably damaging	Het
Kmo	A	T	1: 175,647,152	H134L	probably damaging	Het
Lama3	C	A	18: 12,411,631	Q344K	probably null	Het
Man2a2	A	T	7: 80,368,290	F211I	possibly damaging	Het
Mmp19	T	C	10: 128,795,602	I189T	probably benign	Het
Muc4	G	A	16: 32,755,255	G1710S	unknown	Het
Myo15b	G	A	11: 115,858,784	G127S		Het
Naca	T	C	10: 128,044,243	S1715P	possibly damaging	Het
Ndufs4	T	C	13: 114,288,803	N163S	probably damaging	Het
Nim1k	G	A	13: 119,712,450	R303*	probably null	Het
Nkx6-3	A	T	8: 23,153,691	Y36F	possibly damaging	Het
Osbpl10	C	A	9: 115,176,068	Q188K	probably benign	Het
Pak6	G	T	2: 118,689,997	R156S	probably benign	Het
Pcf11	T	A	7: 92,658,790	K723N	possibly damaging	Het
Pcnx	A	G	12: 81,962,716	Y546C	possibly damaging	Het
Pik3r6	A	G	11: 68,539,957	Y528C	probably damaging	Het
Ppp3cb	T	A	14: 20,531,776	N57I	probably benign	Het
Preb	A	G	5: 30,959,378	L57P	probably damaging	Het
Prkdc	A	G	16: 15,664,368	D425G	probably damaging	Het
Rab35	G	A	5: 115,643,408	V90I	probably damaging	Het
Rab3gap2	G	C	1: 185,262,820	S852T	probably benign	Het
Rcn1	C	T	2: 105,389,119	R243Q	probably null	Het
Rom1	A	G	19: 8,929,101	S25P	probably damaging	Het
Shank3	C	A	15: 89,503,572	Y286*	probably null	Het
Sis	T	A	3: 72,929,409	I837L	probably benign	Het
Ski	T	C	4: 155,160,626	S388G	possibly damaging	Het
Skint1	T	C	4: 112,010,724	F16S	probably benign	Het
Slc22a21	T	G	11: 53,956,078	D323A	possibly damaging	Het
Slc40a1	G	A	1: 45,912,307	T230I	probably damaging	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Spata31d1c	G	T	13: 65,033,177	S30I	probably damaging	Het
Spdl1	G	A	11: 34,813,425	T527I	possibly damaging	Het
Sptb	A	T	12: 76,612,041	L1240Q	probably benign	Het
Tef	T	A	15: 81,802,836	V18D	possibly damaging	Het
Uckl1	T	C	2: 181,574,487	D155G	probably damaging	Het
Vmn1r215	A	G	13: 23,075,867	I26V	probably benign	Het
Wac	A	G	18: 7,871,606	M46V	probably benign	Het
Wbp1	C	T	6: 83,119,885	G146D	probably damaging	Het
Zfand2a	A	C	5: 139,473,791	S147A	probably benign	Het
Zfhx4	A	T	3: 5,399,474	Y1589F	probably benign	Het
Zfp345	G	C	2: 150,472,428	D396E	probably benign	Het

Other mutations in Gm4787

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Gm4787	APN	12	81377174	missense	possibly damaging	0.50
IGL01916:Gm4787	APN	12	81377444	missense	probably benign	0.36
IGL02193:Gm4787	APN	12	81378528	missense	probably benign	0.02
IGL02623:Gm4787	APN	12	81378728	missense	probably damaging	1.00
IGL02681:Gm4787	APN	12	81378769	missense	possibly damaging	0.88
IGL03257:Gm4787	APN	12	81378052	missense	probably damaging	1.00
IGL03410:Gm4787	APN	12	81379174	missense	probably damaging	1.00
F5770:Gm4787	UTSW	12	81377567	nonsense	probably null
PIT4362001:Gm4787	UTSW	12	81377175	missense	probably benign
R0070:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R0128:Gm4787	UTSW	12	81377747	nonsense	probably null
R0220:Gm4787	UTSW	12	81378648	missense	probably damaging	0.98
R0304:Gm4787	UTSW	12	81378934	missense	probably damaging	1.00
R0513:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
R1761:Gm4787	UTSW	12	81377176	missense	probably benign	0.02
R1809:Gm4787	UTSW	12	81378529	missense	possibly damaging	0.91
R1853:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R1854:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R2030:Gm4787	UTSW	12	81378770	missense	probably damaging	1.00
R2063:Gm4787	UTSW	12	81378920	missense	probably benign	0.39
R2112:Gm4787	UTSW	12	81377833	missense	probably damaging	1.00
R2140:Gm4787	UTSW	12	81378562	missense	probably benign	0.03
R2151:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2152:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2342:Gm4787	UTSW	12	81378758	missense	possibly damaging	0.91
R2504:Gm4787	UTSW	12	81379137	missense	possibly damaging	0.93
R4038:Gm4787	UTSW	12	81378358	missense	probably damaging	1.00
R4604:Gm4787	UTSW	12	81379213	missense	probably benign	0.17
R4748:Gm4787	UTSW	12	81378056	missense	probably damaging	1.00
R4750:Gm4787	UTSW	12	81378367	missense	possibly damaging	0.95
R4928:Gm4787	UTSW	12	81378838	missense	probably benign	0.03
R4960:Gm4787	UTSW	12	81379316	missense	probably damaging	0.99
R4974:Gm4787	UTSW	12	81377629	missense	probably damaging	0.99
R5028:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5029:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5031:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5098:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5099:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5100:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5101:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5135:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5152:Gm4787	UTSW	12	81378677	missense	probably benign	0.02
R5180:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5220:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5257:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5258:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5297:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5324:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5325:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5355:Gm4787	UTSW	12	81377465	nonsense	probably null
R5364:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5396:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5397:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5398:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5514:Gm4787	UTSW	12	81378328	missense	possibly damaging	0.90
R5634:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5666:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5670:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5787:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5788:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R6354:Gm4787	UTSW	12	81377981	missense	probably damaging	1.00
R6932:Gm4787	UTSW	12	81379200	missense	probably benign	0.04
R7120:Gm4787	UTSW	12	81378486	missense	probably benign	0.00
R7237:Gm4787	UTSW	12	81377668	missense	probably damaging	0.99
R7937:Gm4787	UTSW	12	81377905	missense	probably benign	0.01
R8022:Gm4787	UTSW	12	81377720	missense	possibly damaging	0.94
R8140:Gm4787	UTSW	12	81378151	missense	probably benign	0.00
R8314:Gm4787	UTSW	12	81379135	missense	probably damaging	1.00
R8480:Gm4787	UTSW	12	81377506	missense	probably damaging	1.00
R8498:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
V7580:Gm4787	UTSW	12	81377567	nonsense	probably null
V7581:Gm4787	UTSW	12	81377567	nonsense	probably null
V7582:Gm4787	UTSW	12	81377567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCATTGTGTGGCTCCAATTAG -3'
(R):5'- ACTTGTGGCCCTGGAAAATACTG -3'

Sequencing Primer
(F):5'- GGCTCCAATTAGTTTAGGATGAAGTC -3'
(R):5'- GGCCCTGGAAAATACTGTAAAAATC -3'

Posted On

2020-10-20