Incidental Mutation 'R8515:Dnah11'
ID656104
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Namedynein, axonemal, heavy chain 11
Synonymsb2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R8515 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location117877982-118199043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117975798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 3196 (V3196I)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: V3196I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: V3196I

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,288,602 D2858V probably benign Het
Aak1 A G 6: 86,925,130 M94V possibly damaging Het
Acss3 A G 10: 106,948,663 I566T possibly damaging Het
Adcy3 T C 12: 4,212,187 V1080A probably damaging Het
Aldh1b1 C T 4: 45,803,818 T452I probably damaging Het
Bptf A T 11: 107,055,238 S2392T possibly damaging Het
Ccnb2 A G 9: 70,413,100 probably null Het
Clec4a4 T A 6: 123,004,023 Y72N probably benign Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Ctbs T A 3: 146,458,813 Y240* probably null Het
Cyp2d22 T C 15: 82,373,912 D169G probably benign Het
Fam110b T C 4: 5,799,380 V266A probably benign Het
Fbxo40 A G 16: 36,970,653 S32P probably damaging Het
Gm4787 T A 12: 81,377,269 H705L probably benign Het
Grik1 A T 16: 87,923,282 Y702* probably null Het
Hao2 A T 3: 98,883,647 N70K probably benign Het
Heatr4 A G 12: 83,954,704 I888T probably damaging Het
Herc4 T A 10: 63,315,786 N935K probably benign Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kif3b C T 2: 153,316,507 T76M probably damaging Het
Kmo A T 1: 175,647,152 H134L probably damaging Het
Lama3 C A 18: 12,411,631 Q344K probably null Het
Man2a2 A T 7: 80,368,290 F211I possibly damaging Het
Mmp19 T C 10: 128,795,602 I189T probably benign Het
Muc4 G A 16: 32,755,255 G1710S unknown Het
Myo15b G A 11: 115,858,784 G127S Het
Naca T C 10: 128,044,243 S1715P possibly damaging Het
Ndufs4 T C 13: 114,288,803 N163S probably damaging Het
Nim1k G A 13: 119,712,450 R303* probably null Het
Nkx6-3 A T 8: 23,153,691 Y36F possibly damaging Het
Osbpl10 C A 9: 115,176,068 Q188K probably benign Het
Pak6 G T 2: 118,689,997 R156S probably benign Het
Pcf11 T A 7: 92,658,790 K723N possibly damaging Het
Pcnx A G 12: 81,962,716 Y546C possibly damaging Het
Pik3r6 A G 11: 68,539,957 Y528C probably damaging Het
Ppp3cb T A 14: 20,531,776 N57I probably benign Het
Preb A G 5: 30,959,378 L57P probably damaging Het
Prkdc A G 16: 15,664,368 D425G probably damaging Het
Rab35 G A 5: 115,643,408 V90I probably damaging Het
Rab3gap2 G C 1: 185,262,820 S852T probably benign Het
Rcn1 C T 2: 105,389,119 R243Q probably null Het
Rom1 A G 19: 8,929,101 S25P probably damaging Het
Shank3 C A 15: 89,503,572 Y286* probably null Het
Sis T A 3: 72,929,409 I837L probably benign Het
Ski T C 4: 155,160,626 S388G possibly damaging Het
Skint1 T C 4: 112,010,724 F16S probably benign Het
Slc22a21 T G 11: 53,956,078 D323A possibly damaging Het
Slc40a1 G A 1: 45,912,307 T230I probably damaging Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Spdl1 G A 11: 34,813,425 T527I possibly damaging Het
Sptb A T 12: 76,612,041 L1240Q probably benign Het
Tef T A 15: 81,802,836 V18D possibly damaging Het
Uckl1 T C 2: 181,574,487 D155G probably damaging Het
Vmn1r215 A G 13: 23,075,867 I26V probably benign Het
Wac A G 18: 7,871,606 M46V probably benign Het
Wbp1 C T 6: 83,119,885 G146D probably damaging Het
Zfand2a A C 5: 139,473,791 S147A probably benign Het
Zfhx4 A T 3: 5,399,474 Y1589F probably benign Het
Zfp345 G C 2: 150,472,428 D396E probably benign Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 splice site probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 splice site probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
R7000:Dnah11 UTSW 12 118017661 missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117922018 frame shift probably null
R7101:Dnah11 UTSW 12 118068145 missense probably benign
R7106:Dnah11 UTSW 12 117961149 missense probably benign 0.15
R7203:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118041095 missense possibly damaging 0.95
R7219:Dnah11 UTSW 12 118126889 missense probably benign 0.00
R7308:Dnah11 UTSW 12 117995275 missense probably damaging 1.00
R7361:Dnah11 UTSW 12 118018742 missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117987442 missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118027477 missense probably benign 0.00
R7399:Dnah11 UTSW 12 118125785 missense probably damaging 1.00
R7404:Dnah11 UTSW 12 118104808 missense probably benign 0.36
R7473:Dnah11 UTSW 12 117903176 missense probably benign 0.19
R7545:Dnah11 UTSW 12 117931204 missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118140770 splice site probably null
R7625:Dnah11 UTSW 12 118196642 missense probably benign
R7761:Dnah11 UTSW 12 118023913 missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118041009 missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117987502 missense probably benign 0.04
R7904:Dnah11 UTSW 12 117903268 missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117966633 missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117878549 missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 118012446 missense probably benign
R8254:Dnah11 UTSW 12 117878524 missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 118027508 nonsense probably null
R8272:Dnah11 UTSW 12 118111017 missense probably benign 0.01
R8344:Dnah11 UTSW 12 118085731 missense probably benign 0.00
RF023:Dnah11 UTSW 12 117954850 missense probably damaging 1.00
RF047:Dnah11 UTSW 12 118010083 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 117931177 missense possibly damaging 0.81
Z1176:Dnah11 UTSW 12 118127119 missense probably benign 0.00
Z1176:Dnah11 UTSW 12 118130799 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTATGCAGATGTGGCTTTTGAC -3'
(R):5'- AACTAAGGCCTCTGTGACCC -3'

Sequencing Primer
(F):5'- CAGATGTGGCTTTTGACTTAAAATTG -3'
(R):5'- CCAAGGTAGAGATCCTAGCCTAC -3'
Posted On2020-10-20