Incidental Mutation 'R8515:Ndufs4'
ID 656107
Institutional Source Beutler Lab
Gene Symbol Ndufs4
Ensembl Gene ENSMUSG00000021764
Gene Name NADH dehydrogenase (ubiquinone) Fe-S protein 4
Synonyms C1-18k, 6720411N02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock # R8515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 114287795-114388258 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114288803 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 163 (N163S)
Ref Sequence ENSEMBL: ENSMUSP00000022286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022286] [ENSMUST00000225035] [ENSMUST00000232101]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022286
AA Change: N163S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022286
Gene: ENSMUSG00000021764
AA Change: N163S

DomainStartEndE-ValueType
Pfam:ETC_C1_NDUFA4 76 170 8.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225035
Predicted Effect probably benign
Transcript: ENSMUST00000225707
Predicted Effect probably benign
Transcript: ENSMUST00000232101
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an nuclear-encoded accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I, or NADH:ubiquinone oxidoreductase). Complex I removes electrons from NADH and passes them to the electron acceptor ubiquinone. Mutations in this gene can cause mitochondrial complex I deficiencies such as Leigh syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, lethargy, loss of motor skills, blindness and decreased mitochondrial CI complex activity beginning at 5 weeks of age followed by death at week 7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,288,602 D2858V probably benign Het
Aak1 A G 6: 86,925,130 M94V possibly damaging Het
Acss3 A G 10: 106,948,663 I566T possibly damaging Het
Adcy3 T C 12: 4,212,187 V1080A probably damaging Het
Aldh1b1 C T 4: 45,803,818 T452I probably damaging Het
Bptf A T 11: 107,055,238 S2392T possibly damaging Het
Ccnb2 A G 9: 70,413,100 probably null Het
Clec4a4 T A 6: 123,004,023 Y72N probably benign Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Ctbs T A 3: 146,458,813 Y240* probably null Het
Cyp2d22 T C 15: 82,373,912 D169G probably benign Het
Dnah11 C T 12: 117,975,798 V3196I probably damaging Het
Fam110b T C 4: 5,799,380 V266A probably benign Het
Fbxo40 A G 16: 36,970,653 S32P probably damaging Het
Gm4787 T A 12: 81,377,269 H705L probably benign Het
Grik1 A T 16: 87,923,282 Y702* probably null Het
Hao2 A T 3: 98,883,647 N70K probably benign Het
Heatr4 A G 12: 83,954,704 I888T probably damaging Het
Herc4 T A 10: 63,315,786 N935K probably benign Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kif3b C T 2: 153,316,507 T76M probably damaging Het
Kmo A T 1: 175,647,152 H134L probably damaging Het
Lama3 C A 18: 12,411,631 Q344K probably null Het
Man2a2 A T 7: 80,368,290 F211I possibly damaging Het
Mmp19 T C 10: 128,795,602 I189T probably benign Het
Muc4 G A 16: 32,755,255 G1710S unknown Het
Myo15b G A 11: 115,858,784 G127S Het
Naca T C 10: 128,044,243 S1715P possibly damaging Het
Nim1k G A 13: 119,712,450 R303* probably null Het
Nkx6-3 A T 8: 23,153,691 Y36F possibly damaging Het
Osbpl10 C A 9: 115,176,068 Q188K probably benign Het
Pak6 G T 2: 118,689,997 R156S probably benign Het
Pcf11 T A 7: 92,658,790 K723N possibly damaging Het
Pcnx A G 12: 81,962,716 Y546C possibly damaging Het
Pik3r6 A G 11: 68,539,957 Y528C probably damaging Het
Ppp3cb T A 14: 20,531,776 N57I probably benign Het
Preb A G 5: 30,959,378 L57P probably damaging Het
Prkdc A G 16: 15,664,368 D425G probably damaging Het
Rab35 G A 5: 115,643,408 V90I probably damaging Het
Rab3gap2 G C 1: 185,262,820 S852T probably benign Het
Rcn1 C T 2: 105,389,119 R243Q probably null Het
Rom1 A G 19: 8,929,101 S25P probably damaging Het
Shank3 C A 15: 89,503,572 Y286* probably null Het
Sis T A 3: 72,929,409 I837L probably benign Het
Ski T C 4: 155,160,626 S388G possibly damaging Het
Skint1 T C 4: 112,010,724 F16S probably benign Het
Slc22a21 T G 11: 53,956,078 D323A possibly damaging Het
Slc40a1 G A 1: 45,912,307 T230I probably damaging Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Spdl1 G A 11: 34,813,425 T527I possibly damaging Het
Sptb A T 12: 76,612,041 L1240Q probably benign Het
Tef T A 15: 81,802,836 V18D possibly damaging Het
Uckl1 T C 2: 181,574,487 D155G probably damaging Het
Vmn1r215 A G 13: 23,075,867 I26V probably benign Het
Wac A G 18: 7,871,606 M46V probably benign Het
Wbp1 C T 6: 83,119,885 G146D probably damaging Het
Zfand2a A C 5: 139,473,791 S147A probably benign Het
Zfhx4 A T 3: 5,399,474 Y1589F probably benign Het
Zfp345 G C 2: 150,472,428 D396E probably benign Het
Other mutations in Ndufs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ndufs4 APN 13 114307870 missense probably null 0.35
IGL03081:Ndufs4 APN 13 114307837 missense possibly damaging 0.52
R2157:Ndufs4 UTSW 13 114316978 missense probably damaging 0.99
R4155:Ndufs4 UTSW 13 114307854 missense probably benign 0.00
R4156:Ndufs4 UTSW 13 114307854 missense probably benign 0.00
R4157:Ndufs4 UTSW 13 114307854 missense probably benign 0.00
R8021:Ndufs4 UTSW 13 114307815 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGAAACTGCCAAGTGTACCTG -3'
(R):5'- CAGTGTTTGGACTTTCACACAC -3'

Sequencing Primer
(F):5'- GCCAAGTGTACCTGTAGTTTAAAGG -3'
(R):5'- GGACTTTCACACACAGGATTG -3'
Posted On 2020-10-20