Incidental Mutation 'R8515:Shank3'
ID656112
Institutional Source Beutler Lab
Gene Symbol Shank3
Ensembl Gene ENSMUSG00000022623
Gene NameSH3 and multiple ankyrin repeat domains 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R8515 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89499623-89560261 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 89503572 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 286 (Y286*)
Ref Sequence ENSEMBL: ENSMUSP00000104932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000109309]
Predicted Effect probably null
Transcript: ENSMUST00000039074
AA Change: Y211*
SMART Domains Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: Y211*

DomainStartEndE-ValueType
ANK 182 211 1.54e-1 SMART
ANK 215 245 3.36e2 SMART
ANK 249 278 2.47e0 SMART
ANK 282 311 3.71e-4 SMART
ANK 315 345 5.03e2 SMART
low complexity region 434 462 N/A INTRINSIC
SH3 473 528 1.28e-14 SMART
PDZ 579 664 3.95e-13 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 813 843 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 905 923 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1173 1194 N/A INTRINSIC
low complexity region 1235 1252 N/A INTRINSIC
low complexity region 1266 1278 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1370 1395 N/A INTRINSIC
low complexity region 1409 1427 N/A INTRINSIC
low complexity region 1552 1558 N/A INTRINSIC
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1626 1658 N/A INTRINSIC
SAM 1664 1730 3.08e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109309
AA Change: Y286*
SMART Domains Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: Y286*

DomainStartEndE-ValueType
low complexity region 5 55 N/A INTRINSIC
Pfam:FERM_f0 84 167 2.5e-14 PFAM
ANK 257 286 1.54e-1 SMART
ANK 290 320 3.36e2 SMART
ANK 324 353 2.47e0 SMART
ANK 357 386 3.71e-4 SMART
ANK 390 420 5.03e2 SMART
low complexity region 509 537 N/A INTRINSIC
SH3 548 603 1.28e-14 SMART
PDZ 654 739 3.95e-13 SMART
low complexity region 747 759 N/A INTRINSIC
low complexity region 888 918 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 980 998 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
low complexity region 1184 1196 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1310 1327 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1416 1430 N/A INTRINSIC
low complexity region 1445 1470 N/A INTRINSIC
low complexity region 1484 1502 N/A INTRINSIC
low complexity region 1627 1633 N/A INTRINSIC
low complexity region 1659 1674 N/A INTRINSIC
low complexity region 1701 1733 N/A INTRINSIC
SAM 1739 1805 3.08e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,288,602 D2858V probably benign Het
Aak1 A G 6: 86,925,130 M94V possibly damaging Het
Acss3 A G 10: 106,948,663 I566T possibly damaging Het
Adcy3 T C 12: 4,212,187 V1080A probably damaging Het
Aldh1b1 C T 4: 45,803,818 T452I probably damaging Het
Bptf A T 11: 107,055,238 S2392T possibly damaging Het
Ccnb2 A G 9: 70,413,100 probably null Het
Clec4a4 T A 6: 123,004,023 Y72N probably benign Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coro2a ACCAGAAGAGCCATCCAG ACCAG 4: 46,544,117 probably null Het
Ctbs T A 3: 146,458,813 Y240* probably null Het
Cyp2d22 T C 15: 82,373,912 D169G probably benign Het
Dnah11 C T 12: 117,975,798 V3196I probably damaging Het
Fam110b T C 4: 5,799,380 V266A probably benign Het
Fbxo40 A G 16: 36,970,653 S32P probably damaging Het
Gm4787 T A 12: 81,377,269 H705L probably benign Het
Grik1 A T 16: 87,923,282 Y702* probably null Het
Hao2 A T 3: 98,883,647 N70K probably benign Het
Heatr4 A G 12: 83,954,704 I888T probably damaging Het
Herc4 T A 10: 63,315,786 N935K probably benign Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Kif3b C T 2: 153,316,507 T76M probably damaging Het
Kmo A T 1: 175,647,152 H134L probably damaging Het
Lama3 C A 18: 12,411,631 Q344K probably null Het
Man2a2 A T 7: 80,368,290 F211I possibly damaging Het
Mmp19 T C 10: 128,795,602 I189T probably benign Het
Muc4 G A 16: 32,755,255 G1710S unknown Het
Myo15b G A 11: 115,858,784 G127S Het
Naca T C 10: 128,044,243 S1715P possibly damaging Het
Ndufs4 T C 13: 114,288,803 N163S probably damaging Het
Nim1k G A 13: 119,712,450 R303* probably null Het
Nkx6-3 A T 8: 23,153,691 Y36F possibly damaging Het
Osbpl10 C A 9: 115,176,068 Q188K probably benign Het
Pak6 G T 2: 118,689,997 R156S probably benign Het
Pcf11 T A 7: 92,658,790 K723N possibly damaging Het
Pcnx A G 12: 81,962,716 Y546C possibly damaging Het
Pik3r6 A G 11: 68,539,957 Y528C probably damaging Het
Ppp3cb T A 14: 20,531,776 N57I probably benign Het
Preb A G 5: 30,959,378 L57P probably damaging Het
Prkdc A G 16: 15,664,368 D425G probably damaging Het
Rab35 G A 5: 115,643,408 V90I probably damaging Het
Rab3gap2 G C 1: 185,262,820 S852T probably benign Het
Rcn1 C T 2: 105,389,119 R243Q probably null Het
Rom1 A G 19: 8,929,101 S25P probably damaging Het
Sis T A 3: 72,929,409 I837L probably benign Het
Ski T C 4: 155,160,626 S388G possibly damaging Het
Skint1 T C 4: 112,010,724 F16S probably benign Het
Slc22a21 T G 11: 53,956,078 D323A possibly damaging Het
Slc40a1 G A 1: 45,912,307 T230I probably damaging Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Spdl1 G A 11: 34,813,425 T527I possibly damaging Het
Sptb A T 12: 76,612,041 L1240Q probably benign Het
Tef T A 15: 81,802,836 V18D possibly damaging Het
Uckl1 T C 2: 181,574,487 D155G probably damaging Het
Vmn1r215 A G 13: 23,075,867 I26V probably benign Het
Wac A G 18: 7,871,606 M46V probably benign Het
Wbp1 C T 6: 83,119,885 G146D probably damaging Het
Zfand2a A C 5: 139,473,791 S147A probably benign Het
Zfhx4 A T 3: 5,399,474 Y1589F probably benign Het
Zfp345 G C 2: 150,472,428 D396E probably benign Het
Other mutations in Shank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Shank3 APN 15 89549416 missense probably damaging 1.00
IGL01469:Shank3 APN 15 89521274 missense probably damaging 1.00
IGL01886:Shank3 APN 15 89531663 missense probably damaging 1.00
IGL01934:Shank3 APN 15 89549846 missense probably damaging 1.00
IGL01989:Shank3 APN 15 89503299 splice site probably benign
IGL02004:Shank3 APN 15 89503299 splice site probably benign
IGL02085:Shank3 APN 15 89503915 critical splice donor site probably null
IGL02195:Shank3 APN 15 89548118 missense probably damaging 1.00
IGL02354:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02361:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02541:Shank3 APN 15 89501410 missense probably damaging 1.00
R0294:Shank3 UTSW 15 89532098 missense probably damaging 1.00
R0468:Shank3 UTSW 15 89549275 missense probably benign 0.28
R0483:Shank3 UTSW 15 89543239 splice site probably benign
R0605:Shank3 UTSW 15 89524147 missense possibly damaging 0.49
R0675:Shank3 UTSW 15 89531388 missense possibly damaging 0.92
R1082:Shank3 UTSW 15 89549371 missense probably damaging 1.00
R1576:Shank3 UTSW 15 89503663 missense probably benign 0.11
R1702:Shank3 UTSW 15 89499896 missense probably damaging 0.99
R1726:Shank3 UTSW 15 89557986 missense probably damaging 1.00
R1958:Shank3 UTSW 15 89503148 missense probably damaging 0.99
R1961:Shank3 UTSW 15 89557964 missense possibly damaging 0.60
R2420:Shank3 UTSW 15 89521210 nonsense probably null
R2513:Shank3 UTSW 15 89548686 missense probably benign 0.05
R3917:Shank3 UTSW 15 89503384 missense possibly damaging 0.77
R4163:Shank3 UTSW 15 89549594 missense probably damaging 1.00
R4205:Shank3 UTSW 15 89503318 missense probably damaging 1.00
R4434:Shank3 UTSW 15 89503359 missense probably damaging 1.00
R4791:Shank3 UTSW 15 89500354 missense probably damaging 1.00
R4816:Shank3 UTSW 15 89543115 missense probably damaging 1.00
R4828:Shank3 UTSW 15 89500199 intron probably benign
R4911:Shank3 UTSW 15 89504344 missense probably damaging 1.00
R4997:Shank3 UTSW 15 89549698 missense probably damaging 1.00
R5213:Shank3 UTSW 15 89533278 missense possibly damaging 0.82
R5338:Shank3 UTSW 15 89531711 splice site probably null
R5494:Shank3 UTSW 15 89548238 missense probably damaging 0.99
R5543:Shank3 UTSW 15 89532354 missense probably damaging 1.00
R5654:Shank3 UTSW 15 89521326 missense probably benign 0.07
R5900:Shank3 UTSW 15 89503390 missense probably damaging 1.00
R5906:Shank3 UTSW 15 89548916 missense probably damaging 1.00
R6385:Shank3 UTSW 15 89521375 critical splice donor site probably null
R6432:Shank3 UTSW 15 89503413 missense possibly damaging 0.75
R6724:Shank3 UTSW 15 89532453 missense probably damaging 1.00
R6822:Shank3 UTSW 15 89531627 missense probably damaging 1.00
R6845:Shank3 UTSW 15 89548325 missense probably benign 0.00
R7088:Shank3 UTSW 15 89503525 splice site probably null
R7390:Shank3 UTSW 15 89549312 missense probably benign 0.05
R7808:Shank3 UTSW 15 89548880 missense probably damaging 1.00
R7862:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
R8039:Shank3 UTSW 15 89505439 missense probably damaging 1.00
R8090:Shank3 UTSW 15 89505458 critical splice donor site probably null
R8170:Shank3 UTSW 15 89548840 missense possibly damaging 0.69
R8189:Shank3 UTSW 15 89549236 missense probably benign
R8246:Shank3 UTSW 15 89533346 missense possibly damaging 0.90
R8525:Shank3 UTSW 15 89547770 missense probably damaging 0.99
R8537:Shank3 UTSW 15 89532215 missense probably damaging 1.00
RF020:Shank3 UTSW 15 89500390 missense probably benign 0.20
Z1177:Shank3 UTSW 15 89558322 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGAAGGTTCTCCGCAAC -3'
(R):5'- TGAAGTATCCCAGACAGAGGC -3'

Sequencing Primer
(F):5'- GTGCTCATCTGGACTTCCGG -3'
(R):5'- GGACCACCTACATACAGCCTGG -3'
Posted On2020-10-20