Incidental Mutation 'R8516:Gria2'
ID 656127
Institutional Source Beutler Lab
Gene Symbol Gria2
Ensembl Gene ENSMUSG00000033981
Gene Name glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms Glur2, Glur-2, GluR-B, GluA2, GluR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 80681450-80802835 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80706987 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 582 (E582G)
Ref Sequence ENSEMBL: ENSMUSP00000074787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075316
AA Change: E582G

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: E582G

DomainStartEndE-ValueType
Pfam:ANF_receptor 49 379 2.7e-58 PFAM
PBPe 415 790 3.75e-132 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107745
AA Change: E582G

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: E582G

DomainStartEndE-ValueType
Pfam:ANF_receptor 47 379 4.8e-53 PFAM
PBPe 415 790 8.16e-133 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192463
AA Change: E582G

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: E582G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 47 379 1.7e-51 PFAM
PBPe 415 770 1.2e-105 SMART
Lig_chan-Glu_bd 425 490 2.2e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Gria2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Gria2 APN 3 80710790 missense probably benign 0.12
IGL00832:Gria2 APN 3 80707251 missense probably damaging 1.00
IGL01086:Gria2 APN 3 80692381 missense probably damaging 1.00
IGL01409:Gria2 APN 3 80707697 critical splice donor site probably null
IGL01924:Gria2 APN 3 80710331 missense probably benign 0.13
IGL01999:Gria2 APN 3 80732091 missense probably damaging 1.00
IGL02355:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02362:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02389:Gria2 APN 3 80709422 missense probably benign 0.14
IGL02444:Gria2 APN 3 80702553 missense possibly damaging 0.65
IGL02532:Gria2 APN 3 80706999 missense probably damaging 1.00
IGL02991:Gria2 UTSW 3 80707809 nonsense probably null
R0015:Gria2 UTSW 3 80707767 missense probably damaging 1.00
R0148:Gria2 UTSW 3 80707731 missense probably damaging 1.00
R0201:Gria2 UTSW 3 80707838 missense probably damaging 1.00
R0411:Gria2 UTSW 3 80710858 splice site probably benign
R0551:Gria2 UTSW 3 80732026 splice site probably benign
R0655:Gria2 UTSW 3 80732070 nonsense probably null
R0866:Gria2 UTSW 3 80722024 splice site probably benign
R1393:Gria2 UTSW 3 80707098 missense probably damaging 1.00
R1458:Gria2 UTSW 3 80732045 missense possibly damaging 0.71
R1563:Gria2 UTSW 3 80691397 missense probably damaging 0.96
R1771:Gria2 UTSW 3 80692301 nonsense probably null
R1775:Gria2 UTSW 3 80691338 missense probably benign 0.09
R1902:Gria2 UTSW 3 80722108 missense probably damaging 0.98
R1993:Gria2 UTSW 3 80802357 missense probably benign
R1994:Gria2 UTSW 3 80802357 missense probably benign
R1995:Gria2 UTSW 3 80802357 missense probably benign
R2001:Gria2 UTSW 3 80710805 missense probably benign 0.28
R2389:Gria2 UTSW 3 80702625 missense probably damaging 1.00
R2520:Gria2 UTSW 3 80706962 missense probably damaging 1.00
R2679:Gria2 UTSW 3 80740953 splice site probably benign
R2865:Gria2 UTSW 3 80732085 missense probably benign 0.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R3716:Gria2 UTSW 3 80741004 missense possibly damaging 0.77
R3967:Gria2 UTSW 3 80710777 missense possibly damaging 0.95
R4285:Gria2 UTSW 3 80707662 intron probably benign
R4611:Gria2 UTSW 3 80692492 missense probably damaging 0.99
R4612:Gria2 UTSW 3 80732051 missense probably damaging 1.00
R4616:Gria2 UTSW 3 80706897 missense probably damaging 1.00
R4706:Gria2 UTSW 3 80740990 missense probably benign
R4996:Gria2 UTSW 3 80707141 missense probably damaging 0.99
R5502:Gria2 UTSW 3 80706945 missense probably damaging 1.00
R5930:Gria2 UTSW 3 80707249 missense possibly damaging 0.91
R6142:Gria2 UTSW 3 80801717 missense probably benign 0.13
R6233:Gria2 UTSW 3 80707203 missense probably damaging 0.99
R6317:Gria2 UTSW 3 80741004 missense possibly damaging 0.79
R6453:Gria2 UTSW 3 80740974 missense possibly damaging 0.93
R6526:Gria2 UTSW 3 80692469 missense probably damaging 1.00
R6545:Gria2 UTSW 3 80741144 missense probably damaging 0.99
R6574:Gria2 UTSW 3 80689296 missense probably damaging 0.99
R6720:Gria2 UTSW 3 80802304 missense probably benign 0.37
R7009:Gria2 UTSW 3 80706972 missense probably damaging 1.00
R7049:Gria2 UTSW 3 80689327 missense probably damaging 0.99
R7191:Gria2 UTSW 3 80732085 missense probably benign 0.24
R7225:Gria2 UTSW 3 80802631 unclassified probably benign
R7374:Gria2 UTSW 3 80741076 missense probably benign
R7837:Gria2 UTSW 3 80710788 missense probably benign 0.18
R8034:Gria2 UTSW 3 80801699 missense probably damaging 1.00
R8125:Gria2 UTSW 3 80707243 missense possibly damaging 0.88
R8189:Gria2 UTSW 3 80722182 missense probably damaging 1.00
R8209:Gria2 UTSW 3 80709457 missense probably benign 0.01
R8362:Gria2 UTSW 3 80707890 missense possibly damaging 0.82
R8481:Gria2 UTSW 3 80801691 missense possibly damaging 0.95
R8500:Gria2 UTSW 3 80692467 missense probably damaging 0.99
R8918:Gria2 UTSW 3 80692399 missense probably damaging 1.00
R8939:Gria2 UTSW 3 80710863 intron probably benign
R8971:Gria2 UTSW 3 80707893 missense probably damaging 0.98
R9229:Gria2 UTSW 3 80802382 start codon destroyed probably null 0.60
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTGACATCTTTATAGTG -3'
(R):5'- GAAGCCATTCATGAGCCTTG -3'

Sequencing Primer
(F):5'- GCTGCTGACATCTTTATAGTGAATTC -3'
(R):5'- GAAGCCATTCATGAGCCTTGGAATC -3'
Posted On 2020-10-20