Incidental Mutation 'R8516:Ppp3ca'
ID 656130
Institutional Source Beutler Lab
Gene Symbol Ppp3ca
Ensembl Gene ENSMUSG00000028161
Gene Name protein phosphatase 3, catalytic subunit, alpha isoform
Synonyms Caln, PP2BA alpha, 2900074D19Rik, PP2B alpha 1, Calna, CnA, CN
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 136670124-136937727 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 136877768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 212 (I212N)
Ref Sequence ENSEMBL: ENSMUSP00000053101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056758] [ENSMUST00000070198]
AlphaFold P63328
Predicted Effect probably damaging
Transcript: ENSMUST00000056758
AA Change: I212N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053101
Gene: ENSMUSG00000028161
AA Change: I212N

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070198
AA Change: I212N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071040
Gene: ENSMUSG00000028161
AA Change: I212N

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 497 509 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation and abnormal mossy fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Ppp3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp3ca APN 3 136935181 missense probably benign 0.01
IGL01405:Ppp3ca APN 3 136868721 missense probably benign 0.33
IGL02061:Ppp3ca APN 3 136797863 missense probably benign
IGL02285:Ppp3ca APN 3 136928626 splice site probably benign
IGL02472:Ppp3ca APN 3 136921862 missense possibly damaging 0.57
IGL02706:Ppp3ca APN 3 136905318 missense possibly damaging 0.84
IGL02894:Ppp3ca APN 3 136797812 missense probably damaging 1.00
R0325:Ppp3ca UTSW 3 136935139 missense probably benign 0.15
R1072:Ppp3ca UTSW 3 136935127 missense probably benign
R1427:Ppp3ca UTSW 3 136921914 missense probably damaging 1.00
R1524:Ppp3ca UTSW 3 136797818 missense probably benign
R1568:Ppp3ca UTSW 3 136928544 missense probably benign 0.00
R1754:Ppp3ca UTSW 3 136881448 missense probably benign 0.20
R1800:Ppp3ca UTSW 3 136935031 missense probably damaging 0.98
R1844:Ppp3ca UTSW 3 136921911 missense probably benign 0.08
R1878:Ppp3ca UTSW 3 136797878 missense probably benign 0.03
R2155:Ppp3ca UTSW 3 136890450 missense possibly damaging 0.95
R2160:Ppp3ca UTSW 3 136877630 missense probably damaging 1.00
R2220:Ppp3ca UTSW 3 136797924 missense probably damaging 1.00
R2331:Ppp3ca UTSW 3 136797819 missense probably benign
R3052:Ppp3ca UTSW 3 136797844 missense probably benign 0.00
R3500:Ppp3ca UTSW 3 136881512 missense probably benign 0.00
R4764:Ppp3ca UTSW 3 136890489 missense probably damaging 0.99
R4974:Ppp3ca UTSW 3 136935049 missense possibly damaging 0.60
R5952:Ppp3ca UTSW 3 136928571 missense probably benign 0.08
R6051:Ppp3ca UTSW 3 136876122 missense probably damaging 1.00
R6395:Ppp3ca UTSW 3 136877770 missense possibly damaging 0.47
R6975:Ppp3ca UTSW 3 136905301 missense probably damaging 1.00
R7121:Ppp3ca UTSW 3 136868626 missense probably damaging 1.00
R7720:Ppp3ca UTSW 3 136890489 missense probably damaging 1.00
R7773:Ppp3ca UTSW 3 136890461 missense probably benign
R7828:Ppp3ca UTSW 3 136797774 missense probably damaging 1.00
R7830:Ppp3ca UTSW 3 136868720 missense probably damaging 1.00
R8108:Ppp3ca UTSW 3 136932225 splice site probably null
R8126:Ppp3ca UTSW 3 136903191 missense probably damaging 0.99
R8285:Ppp3ca UTSW 3 136881444 missense probably damaging 1.00
R8537:Ppp3ca UTSW 3 136797858 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCAGTGTCAATGAGATGGC -3'
(R):5'- TTACAAGGTGATGCGCCAAAC -3'

Sequencing Primer
(F):5'- CAGTGTCAATGAGATGGCCCTAGTC -3'
(R):5'- CCCAGTCCCTAAGCTAAATATTGG -3'
Posted On 2020-10-20