Incidental Mutation 'R8516:Adamtsl1'
ID 656132
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene Name ADAMTS-like 1
Synonyms 5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 85514172-86428385 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86342543 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1005 (Y1005C)
Ref Sequence ENSEMBL: ENSMUSP00000102796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]
AlphaFold Q8BLI0
Predicted Effect probably damaging
Transcript: ENSMUST00000107178
AA Change: Y1005C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: Y1005C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141889
AA Change: Y997C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: Y997C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
R7908:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R7934:Adamtsl1 UTSW 4 86243725 missense probably damaging 1.00
R8056:Adamtsl1 UTSW 4 86342032 missense possibly damaging 0.76
R8109:Adamtsl1 UTSW 4 86248069 missense
R8143:Adamtsl1 UTSW 4 86342255 missense possibly damaging 0.71
R8205:Adamtsl1 UTSW 4 86199413 makesense probably null
R8215:Adamtsl1 UTSW 4 86343145 missense probably benign 0.45
R8250:Adamtsl1 UTSW 4 86342609 missense probably damaging 1.00
R8261:Adamtsl1 UTSW 4 86276883 missense probably damaging 0.99
R8417:Adamtsl1 UTSW 4 86156689 missense possibly damaging 0.81
R8494:Adamtsl1 UTSW 4 86321984 missense probably damaging 0.99
R8525:Adamtsl1 UTSW 4 86277010 missense probably damaging 1.00
R8688:Adamtsl1 UTSW 4 86248026 missense
R8698:Adamtsl1 UTSW 4 86388477 missense probably benign 0.01
R8778:Adamtsl1 UTSW 4 85514450 missense probably benign 0.01
R9015:Adamtsl1 UTSW 4 86232610 missense probably damaging 1.00
R9127:Adamtsl1 UTSW 4 86289790 missense probably benign
R9326:Adamtsl1 UTSW 4 86232567 missense possibly damaging 0.70
R9336:Adamtsl1 UTSW 4 86322027 missense probably benign 0.00
R9394:Adamtsl1 UTSW 4 86216988 missense
R9416:Adamtsl1 UTSW 4 86424240 missense probably damaging 1.00
Z1176:Adamtsl1 UTSW 4 86342177 missense probably damaging 0.99
Z1176:Adamtsl1 UTSW 4 86342693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGAGCAGTTTGTGATTAAGCTC -3'
(R):5'- CAGGTTCCTGAGGATGTCATC -3'

Sequencing Primer
(F):5'- TTAAGCTCATTGGAGGCAACC -3'
(R):5'- GTTCCTTTCTGCAGAGTC -3'
Posted On 2020-10-20