Incidental Mutation 'R8516:Elavl4'
ID 656133
Institutional Source Beutler Lab
Gene Symbol Elavl4
Ensembl Gene ENSMUSG00000028546
Gene Name ELAV like RNA binding protein 4
Synonyms Hud
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 110203722-110351909 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110251379 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 56 (N56S)
Ref Sequence ENSEMBL: ENSMUSP00000102207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102722] [ENSMUST00000102723] [ENSMUST00000106597] [ENSMUST00000106598] [ENSMUST00000106600] [ENSMUST00000106601] [ENSMUST00000106603] [ENSMUST00000138972] [ENSMUST00000142722] [ENSMUST00000153906]
AlphaFold Q61701
Predicted Effect probably damaging
Transcript: ENSMUST00000102722
AA Change: N56S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099783
Gene: ENSMUSG00000028546
AA Change: N56S

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 289 362 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102723
AA Change: N51S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099784
Gene: ENSMUSG00000028546
AA Change: N51S

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 298 371 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106597
AA Change: N56S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102207
Gene: ENSMUSG00000028546
AA Change: N56S

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 303 376 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106598
AA Change: N51S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102208
Gene: ENSMUSG00000028546
AA Change: N51S

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106600
AA Change: N68S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102210
Gene: ENSMUSG00000028546
AA Change: N68S

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
RRM 64 137 7.57e-24 SMART
RRM 150 225 1.35e-20 SMART
low complexity region 231 245 N/A INTRINSIC
RRM 301 374 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106601
AA Change: N51S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102212
Gene: ENSMUSG00000028546
AA Change: N51S

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106603
AA Change: N54S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102214
Gene: ENSMUSG00000028546
AA Change: N54S

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
RRM 50 123 7.57e-24 SMART
RRM 136 211 1.35e-20 SMART
low complexity region 217 231 N/A INTRINSIC
RRM 274 347 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138972
AA Change: N49S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123014
Gene: ENSMUSG00000028546
AA Change: N49S

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
RRM 45 118 7.57e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142722
AA Change: N64S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121828
Gene: ENSMUSG00000028546
AA Change: N64S

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
Pfam:RRM_1 61 92 1.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153906
AA Change: N49S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120942
Gene: ENSMUSG00000028546
AA Change: N49S

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:RRM_1 46 95 1.3e-14 PFAM
Pfam:RRM_6 46 95 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased neural progenitor self-renewal and impaired neuronal differentiation, partial penetrance of hind limb clasping, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Elavl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Elavl4 APN 4 110206612 missense probably benign 0.03
IGL01777:Elavl4 APN 4 110206661 critical splice acceptor site probably null
IGL02212:Elavl4 APN 4 110206412 missense probably damaging 1.00
IGL03053:Elavl4 APN 4 110251494 missense possibly damaging 0.89
R0386:Elavl4 UTSW 4 110206705 intron probably benign
R1141:Elavl4 UTSW 4 110251368 nonsense probably null
R1826:Elavl4 UTSW 4 110251292 missense probably damaging 1.00
R5155:Elavl4 UTSW 4 110292636 missense probably null 0.22
R5294:Elavl4 UTSW 4 110211430 missense possibly damaging 0.90
R5507:Elavl4 UTSW 4 110213206 missense probably benign 0.17
R5558:Elavl4 UTSW 4 110206603 missense probably benign 0.37
R5927:Elavl4 UTSW 4 110290243 unclassified probably benign
R5987:Elavl4 UTSW 4 110290644 missense probably benign 0.40
R6376:Elavl4 UTSW 4 110255454 start gained probably benign
R6504:Elavl4 UTSW 4 110255382 splice site probably null
R6987:Elavl4 UTSW 4 110251405 missense possibly damaging 0.70
R7278:Elavl4 UTSW 4 110211425 critical splice donor site probably null
R7431:Elavl4 UTSW 4 110226633 missense probably damaging 1.00
R7717:Elavl4 UTSW 4 110206466 missense probably damaging 1.00
R7979:Elavl4 UTSW 4 110211648 missense probably benign 0.12
R8963:Elavl4 UTSW 4 110206579 missense probably damaging 1.00
R9216:Elavl4 UTSW 4 110251349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTGCTCAGATGTGCTACC -3'
(R):5'- TGTGTTCACAGCCCAGTCTC -3'

Sequencing Primer
(F):5'- TGTGCTACCACACACGTG -3'
(R):5'- ACAGCCCAGTCTCTCTGC -3'
Posted On 2020-10-20